Labshake search
Citations for American BioInnovations, :
251 - 283 of 283 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Genetics 2019Quote: ... Where gene expression was measured by quantitative real-time PCR TaqMan® Gene Expression Assays Applied Biosystems (ABI, www.appliedbiosystems.com) were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was run in 384-well plates on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (ABI) and analyzed in Microsoft Excel.
-
bioRxiv - Developmental Biology 2022Quote: ... was employed to measure the mRNA expression of genes involved in this pathway using real-time PCR (ABI 7500). The changes in the mRNA fold expression difference were calculated by the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Dissociation curve analyses were then performed on the 7900HT Fast Real-Time PCR instrument using the SDS2.4 software to detect presence or absence of amplified products (both ABI).
-
bioRxiv - Neuroscience 2021Quote: ... Synthesized cDNA was used for qPCR by 2× ChamQTM Universal SYBR qPCR Master Mix (Vazyme) on StepOnePlusTM Real-Time PCR System (ABI) or BioRad CFX96 Touch Real-Time PCR system ...
-
bioRxiv - Cell Biology 2021Quote: ... All real-time PCR was carried out with Power SYBR Green PCR master mix on the ABI prism 7900 HT sequence detection system (ABI) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... CD44 and CD24 - was undertaken by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) of total RNAs using an ABI7300 thermal cycling system (ABI) and the SsoAdvance SYBR green mixture (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... by using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR (ABI). The qPCR signals were normalized to those of the reference gene PST in pine trees ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Vazyme, China) and detected by ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.2 and 0.04 ng/µl to generate standard curves with StepOnePlus Real-Time PCR System v2.2 (ABI, Thermo Fisher Scientific). Primer quality was 125% efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... Messenger RNA levels were quantified by using the StepOnePlus Real-Time PCR System with Fast SYBR Green Master Mix (ABI). rp49 was used as internal control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were submitted for sequencing at the University of Florida DNA Sequencing Core Laboratory (ICBR, Gainesville, Florida) using standard fluorescent cycle-sequencing PCR reactions (ABI Prism Big Dye terminator chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... with Hieff™ qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR system (ABI). The qPCR signals were normalized to those of the reference gene PST in Pinus by applying the 2-ΔΔCT method (Fang et al. ...
-
bioRxiv - Genomics 2020Quote: The purified cDNA or dsDNA samples were assayed by quantitative PCR with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) using custom designed primers (Additional file 3 ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified and detected by SYBR Green PCR Master Mix kit (bao bio-engineering Co., Ltd, China) on the ABI7500 instrument (ABI, USA). For qRT-PCR reactions ...
-
bioRxiv - Neuroscience 2019Quote: ... Biological (R3) and technical (R2) replicates were analyzed with Sybr Green Real-Time PCR (BioRad, ABI PRISM 7700 Sequence Detection System) performed using the following PCR conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl diluted cDNA in Optical 8-Tube Strip using the Applied Biosystems 7300 Real-Time PCR Instrument (ABI, USA). The conditions for real-time PCR were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR reactions using the PowerUp™ SYBR Green Master Mix were carried out on the QuantStudio 12K Flex Real-Time PCR System (ABI) (ABI ...
-
bioRxiv - Genetics 2022Quote: ... The gene-specific primers of the Pm69 and the housekeeping gene Ubiquitin were used for qRT-PCR amplification performed on a StepOne thermal cycler (ABI, USA) in a volume of 10 μl containing 5 μl of SYBR Green FastMix (Quantabio ...
-
bioRxiv - Physiology 2022Quote: ... Each cDNA sample was analyzed in triplicate with the Applied Biosystems Prism7900HT Real-Time PCR System using Absolute SYBR Green (ABI, USA). The primer sequences were listed in (Supplementary Table 3).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were verified by 2% agarose electrophoresis gel and subjected to sequencing by using a 3730XL DNA Analyzer (ABI, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... and quantified using KAPA Library Quantification Kits (KAPA Bio, cat# KK4824) and the 7500 Real-Time PCR System (ABI, cat# 7500-01). The libraries were sequenced as 150 bp paired-end reads using the NovaSeq 6000 Sequencing System (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and quantified using KAPA Library Quantification Kits (KAPA Bio, cat# KK4824) and the 7500 Real-Time PCR System (ABI, cat# 7500-01). The libraries were sequenced using NovaSeq 6000 with 150 bp paired end reads ...
-
bioRxiv - Neuroscience 2021Quote: ... The quantitative real-time Reverse Transcription-PCR (qPCR) analysis was performed using the Fast SYBR Green Master Mix (ABI Applied Biosystems, USA). Results were determined using respective standard curves calculations ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR reactions using the PowerUp™ SYBR Green Master Mix were carried out on the QuantStudio 12K Flex Real-Time PCR System (ABI) (ABI, A25742). Data were analyzed by the 2−ΔΔCT relative quantification method ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of each replicate was analyzed by nested quantitative PCR (45 cycles of 95 C for 15 seconds and 60 ℃ for 1 minute) using Fast Advanced Master Mix (ABI Life Technologies) in an ABI StepOnePlus Real-Time PCR machine ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1-10 ng template in 9 μl Nuclease-free water were added to 10.0 μL of 2× TaqMan® Universal PCR master mix (ABI/Life technologies, USA) and 1.0 μL of a 20× combined primers and probes mix (ABI/Life Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... using a QuantStudio™ 7 Flex device and results were analyzed with QuantStudio™ Real-Time PCR software (both ABI, Waltham, MA, USA)
-
bioRxiv - Genomics 2022Quote: ... and gene expressions of apoLp and POA3-like after male feeding on dsRNAapoLp were evaluated by qRT-PCR analysis (ABI StepOne Plus, Foster, CA) using TB Green Premix Ex Taq II (Catalog No ...
-
bioRxiv - Genomics 2022Quote: ... was used for RSV subtype detection with TaqPath 1-Step Multiplex Master Mix (No ROX) on Applied Biosystems 7500 Real-Time PCR System (ABI, Life Technologies, Waltham, MA) as instructed ...
-
bioRxiv - Cancer Biology 2019Quote: ... tumor necrosis factor α (TNF-α) and TATA box binding protein (TBP) were determined by real☐time PCR (ABI 7900 Prism, Applied Biosystems, US). Sequences used to amplify a fragment of IL-6 were FP ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed using TAQMAN gene expression master mix of equivalent amounts of total cDNA for forty cycles (ABI GeneAmp 9700 DNA thermal cycler). Endpoint data was assembled by comparison of Delta-Ct values for HN1 versus corresponding GAPDH Delta-Ct values for each cell line ...