Labshake search
Citations for American BioInnovations, :
101 - 150 of 283 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed in triplicate for each sample on a Viia7 instrument (ABI) using Power SYBR Green PCR Master Mix (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... q-PCR amplification was performed by ABI 7900HT fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... it was performed by ABI Real-Time PCR Detection System (ABI, Q5) using the Hieff® qPCR SYBR Green Master Mix (Low Rox Plus ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real-Time PCR System (ABI, CA, USA) using PowerUp SYBR Green PCR Master Mix (Thermo Fisher Scientific ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... on ViiA7 Real-time pcr system (ABI). Relative enrichment was calculated using percent input method using formula 100 × 2~(Adjusted input - Ct (IP).
-
bioRxiv - Molecular Biology 2021Quote: ... SYBR Green PCR Master Mix (ABI 4309155) was used for cDNA amplification in a real-time fluorescence quantitative PCR instrument (ABI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR (qPCR) was performed by ABI Quant Studio 3 series PCR machine (Applied Biosystem ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR reactions were performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR Instrument (ABI). Delta-delta-cycle threshold (ΔΔCT ...
-
bioRxiv - Pathology 2022Quote: ... Real-time PCR was carried out in an Applied Biosystems QuantStudio 5 Real-Time PCR System (ABI, Warrington, UK) with SYBR Green PCR master mix (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI).
-
bioRxiv - Neuroscience 2021Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the StepOnePlus System (ABI) and SYBR qPCR Powermix (ABI) ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the 7500 detection system (ABI) and SYBR qPCR Premix (Clontech) ...
-
bioRxiv - Microbiology 2020Quote: ... A new probe that would complement the primers and be compatible with TaqMan qPCR requirements (ABI 7700 Users Manual) was designed by using Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2019Quote: The qPCR reactions were performed with samples in triplicate on an ABI 7500 fast real-time PCR system using power SYBR green PCR master mix (ABI). The mouse TRPV1 cDNA was amplified with primers 5’-TTCCTGCAGAAGAGCAAGAAGC-3’ and 5’-CCCATTGTGCAGATTGAGCAT-3’ (Albers et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR reactions were performed with the TOYOBO SYBR Green Realtime PCR Master Mix (TOYOBO) and analyzed with a step-one Plus PCR system (ABI). Lotus Ubiquitin (Lj5g3v2060710.1 ...
-
bioRxiv - Microbiology 2023Quote: ... was performed using SYBR Green Real-time PCR Master Mix (QPK-201, Toyobo) with the QuantStudio 6 Flex multicolor real-time PCR detection system (ABI). Relative mRNA levels were normalized to GAPDH levels and calculated using the 2-ΔΔCT method (Livak & Schmittgen ...
-
bioRxiv - Immunology 2021Quote: ... in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Probes for quantititative PCR were purchased from ABI: hypoxanthine-guanine phosphoribosyl transferase 1 (HPRT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction system (ABI QuantStudio 3) included ...
-
bioRxiv - Developmental Biology 2020Quote: ... in a 7300 real-time PCR system (ABI). For data analysis the simplified method after Pfaffl (88 ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was done on 7900HT (ABI) machine using Fast Fire qPCR Premix (Probe ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR was performed on an Applied Biosystems (ABI) 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... PCR was performed using ABI7900HT (ABI Company, USA) according to established methods ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 7500FAST real-time PCR system (ABI) as previously described (46) ...
-
bioRxiv - Genetics 2023Quote: ... qRT-PCR was performed (ABI-Q6, California, USA) in a 20 µL reaction ...
-
bioRxiv - Microbiology 2023Quote: ... PE5700 automatic fluorescent quantitative PCR analyzer (ABI, USA); CKX41 inverted microscope (Olympus ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: ... The NLS encoding region was amplified using specific primers at an annealing temperature of 550C using Amplitaq GoldTM (ABI Inc.). The PCR product was sequenced using the 3100 genetic analyzer (ABI Inc.).
-
bioRxiv - Plant Biology 2021Quote: ... The template concentration was 10-15 ng while the concentration of forward and reverse primer was 10 ng in SYBR select Master Mix (ABI). The PCR was performed using the ABI 7700 sequence detector (Applied Biosystems ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative real-time PCR assays were performed under a Real-time PCR Detection System of QuantStudio™6 Flex (ABI, USA) in a 384-well plate format using SYBR Green PCR (TOYOBO ...
-
ARID1a protects against steatosis and insulin resistance via PPARalpha-mediated fatty acid oxidationbioRxiv - Cell Biology 2019Quote: RNA extracted from liver or hepatocytes were subjected to reverse transcription and subsequent PCR using a real-time PCR system (ABI, Carlsbad, CA). PCR primer sequences are listed in Supplemental Table 1 ...
-
bioRxiv - Genetics 2020Quote: Assays using the GPS™ COVID-19 dtec-RT-qPCR kit (Alicante, Spain) were prepared and reaction mixtures were subjected to qPCR in a QuantStudio3 (ABI) as described in the manual provided ...
-
bioRxiv - Immunology 2021Quote: ... and quantified by real time PCR (ABI Applied Biosystem) as in 53 ...
-
bioRxiv - Cell Biology 2019Quote: ... ABI Power SYBR Green PCR Master Mix (ABI, USA) was used in conjunction with a PCR machine model ABI StepOne Plus Real-time PCR (Applied Biosystems) ...
-
bioRxiv - Physiology 2021Quote: ... was used on ViiA7 Real-Time PCR systems (ABI). The ΔΔCt method was used to analyze the relative changes in gene expression ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the StepOnePlus™ Real-Time PCR System (ABI). Primer sequences ...
-
bioRxiv - Cell Biology 2020Quote: ... and the StepOnePlus Real-Time PCR System (ABI, USA), following the manufacturers’ manuals ...
-
bioRxiv - Cell Biology 2020Quote: ... and the StepOnePlus Real-Time PCR System (ABI, USA) following the manufacturers’ manuals ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purified PCR products were cycle sequenced using BigDye (ABI PRISM® BigDye Terminator v3.1 Cycle Sequencing Kits ...
-
bioRxiv - Neuroscience 2022Quote: ... SYBR-green PCR (Fast SYBR green master mix, ABI) was used to amplify Gapdh and Myod1 ...
-
bioRxiv - Microbiology 2022Quote: ... in a StepOnePlus Real-Time PCR system (ABI, 4376600) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplification was performed with the Applied Biosystems (ABI) BigDye Direct kit PCR master mix or NEB OneTaq standard buffer ...
-
bioRxiv - Physiology 2023Quote: ... on a StepOnePlus Real Time PCR workstation (Thermo/ABI). Libraries were sequenced on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a StepOnePlus real time PCR workstation (Thermo/ABI). Libraries were sequenced on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Systems Biology 2020Quote: ... genomic DNA was digested and genes and microRNAs were measured using multiplex RT-qPCR (BioMark by Fluidigm) or standard EvaGreen-based qPCR (ABI 7000).
-
bioRxiv - Microbiology 2021Quote: ... and a reverse primer (R2913) downstream of the BamHI site of pMAL-p5x) with a BigDye® terminator V3.1 cycle sequencing kit (ABI/Thermo-Fisher). Amylose resin (E8021S ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Genomics 2019Quote: ... on the QuantStudio 12K Flex Real-Time PCR System (ABI). Relative expression levels were defined using the DDCt method and normalising to 36B4/RPLP0 ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was performed on an Applied Biosystems (ABI) ViiA 7 Real-Time PCR System. ...
-
bioRxiv - Plant Biology 2021Quote: ... Conditions for sRT-PCR on Veriti Thermal Cycler (ABI, USA) were as follows ...