Labshake search
Citations for Drummond Scientific :
151 - 200 of 252 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Immunology 2023Quote: ... with 4.6 nL of TRIS (10 mM pH7.5) or DCV (500PFU) by intrathoracic injection (Nanoject II apparatus; Drummond Scientific). Flies were kept at 25°C for either 2 or 3 days ...
-
bioRxiv - Microbiology 2020Quote: ... mosquitoes were injected with 138 nL WT or S411A Kunjin virus (~345 PFU/mosquito) using a Nanoject II (Drummond Scientific). Engorged female mosquitoes were maintained for up to 15 days under conditions described above but in the BSL3 insectary and mortality rate counted daily ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... Small craniotomies were made over the injection sites and 1.0 µL of virus was delivered bilaterally to dorsolateral striatum via a Nanoject II (Drummond Scientific) at a rate of 0.1 µL/min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The females were injected into thorax with 138 nl of ∼20 µM dsRNA targeting vrille or LacZ using Nanoject II Auto-nanoliter Injector with 3.5” Drummond glass capillaries (Drummond Scientific) pulled with P-97 Flaming/Brown Micropipette Puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2021Quote: Viral vectors were stored at -80 °C prior to use and were backfilled into Wiretrol II pipettes (Drummond Scientific Company) pulled on a P-1000 Flaming/Brown micropipette puller (Sutter Instruments) ...
-
bioRxiv - Neuroscience 2019Quote: ... or Slack (0.5 ng/nl) plus Scyl1 (0.5 ng/nl) was injected into each oocyte using a Drummond Nanoject II injector (Drummond Scientific). Injected oocytes were incubated at 18°C in ND96 medium (in mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... DV 2.6mm from pia) using an automated microprocessor controlled microinjection pipette with micropipettes pulled from borosilicate capillaries (Nanoject II, Drummond Scientific). Injections were performed at 0.2 Hz with 2.3 nL injection volumes per pulse ...
-
bioRxiv - Neuroscience 2019Quote: ... total volume of 0.25 μl) was microinfused into the brain using a Nanoject II auto-nanoliter injector (Drummond Scientific Co.) secured to the arms of the stereotaxic frame ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered by glass pipette to two sites −2.5 mm and −3.0 mm ventral to brain surface for a total volume of 0.8 µL at 9.2 nl/ 5sec using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company), after which the pipette was left in place for 10 minutes before being slowly retracted ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Biophysics 2024Quote: ... mRNA (40-50nL) was injected into defolliculated Xenopus leavis oocytes (purchased from Ecocyte) using a Nanoject II nanoinjector (Drummond Scientific) and electrophysiological experiments were performed 2 to 5 days after injection.
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid solution was injected into the lateral ventricle using needles for injection that were pulled from Wiretrol II glass capillaries (Drummond Scientific) and calibrated for 1-μl injections ...
-
bioRxiv - Developmental Biology 2021Quote: ... virgin females were anesthetized on ice and injected with 2.0 μg dsRNA (400 nl) using a Nanoject II microinjector (Drummond Scientific Company). After injection ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered to left ventricle at a depth of approximately 1.1 mm underneath skull through a beveled glass pipette using Nanoject II injector (Drummond Scientific, Inc.). AAV9.ChR2-mCherry (400 nL ...
-
bioRxiv - Genetics 2019Quote: ... was injected into the thorax of cold-anesthetized 1 d-old female mosquitoes using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific). Mosquitoes were injected with dsRNA specific for the target gene ...
-
bioRxiv - Molecular Biology 2019Quote: ... mosquitoes were anesthetized with CO2 and microinjected with 207 nl of 200 μM antagomir (41 pmol/female) at 12-18 h post eclosion using the Drummond NanoJect II (Drummond Scientific). Mosquitoes were left for four days to recover before a blood feeding or P ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... Injections were performed using a pulled glass pipette (10 –15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Each individual injection was performed at a speed of 23 nL/s ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of ∼240 nL (41.4 nL x 6 at 23 nL/sec) was pressure-injected on each side using the Nanoject II (Drummond Scientific Company). The pipette was held in place for 5 minutes after injection to allow diffusion before being slowly retracted from the brain ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a speed of 23 nL/injection (inter-injection interval 15-30 s) using a microinjection pipette injector (Nanoject II, Drummond Scientific). A 200 µm optic fiber (Thorlabs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus was delivered at a speed of 46 nl s−1 into the thorax using a pulled glass capillary needle and a manual microinjector (Nanoject II; Drummond Scientific). This controlled the infection dose by removing the variation that would have resulted from oral feeding ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Microbiology 2021Quote: ... 18.6 nL of the mixture was injected into the second-instar nymph using a Nanoinject II auto-nanoliter injector (Drummond Scientific). The injected nymphs were reared on fresh rice seedlings and photographed with an Olympus stereomicroscope SEX16 (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... An approximate total of 500-750 nL of Cholera toxin subunit B (CTB) AlexaFluor 488 or 647 Conjugate (Invitrogen) (Nanoject II, Drummond Scientific) was injected into 2-3 different locations in the left forepaw (Intrinsic Hand (IH ...
-
bioRxiv - Neuroscience 2020Quote: ... Equivalent dose of lentivirus 1.0 μL of pLenti-CaMKII-TRPV1-p2A-mCherry-WPRE solution or 0.64 μL pLenti-CaMKII-mCherry-WPRE) was injected into the somatosensory cortex of Thy1-GCaMP6f mice using a microinjector (Nanoject II; Drummond Scientific) at a speed of 0.69 μL /min ...
-
bioRxiv - Neuroscience 2019Quote: ... Unilateral injections were performed using a pulled glass pipette (10-15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Approximately 30 nl of virus was deposited at each injection site at 1-2 minute intervals (from bregma in mm ...
-
bioRxiv - Plant Biology 2020Quote: ... 46 nL/23 ng of cRNA or equal volumes of RNase-free water were injected into oocytes with a Nanoinject II microinjector (Drummond Scientific). Oocytes were incubated for 48 h in Calcium Ringer’s solution (96 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1 to 0.3 μl of AAV1-EF1a-DIO-hChR2-eYFP-WPRE-hGH (University of Pennsylvania vector core) was injected into the target area of GAD2-Cre mice using Nanoject II (Drummond Scientific) via a glass micropipette (dorsoventral (DV ...
-
bioRxiv - Bioengineering 2020Quote: ... was made and a total of 2 µl of MENPs or MSNPs were injected with a microinjection apparatus Nanoject II (Drummond Scientific). In phase-I in vivo experiment MENPs injection was conducted only in right hemisphere to compare microglia and astrocytes population between injected and intact hemispheres ...
-
bioRxiv - Molecular Biology 2021Quote: ... Female mosquitoes were injected intrathoracically (Ramirez et al., 2012) with dsRNA (0.4 μg) with a microinjector (NanoJect II Autonanoliter injector, Drummond Scientific, USA). Injected mosquitoes were maintained at 28 °C ...
-
bioRxiv - Genetics 2021Quote: Three- to five-day-old female adults were injected with 50 nl of 10 mM adenosine solution using a NANOJECT II (Drummond Scientific); control flies were injected with 50 nl of 1× PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... University of Pennsylvania Vector Core) using an automated microprocessor controlled microinjection pipette with micropipettes pulled from borosilicate capillaries (Nanoject II, Drummond Scientific). Injections were performed at 0.2 Hz with 2.3 nL injection volumes per pulse ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Immunology 2022Quote: ... The needle was backfilled with the oil solution with a syringe and attached to a nanoinjector (Drummond Scientific Co. Nonoject II). Late 2nd instar and early 3rd instar larvae were carefully removed with forceps from cornmeal food plates and placed on filter paper ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... VVF ETH Zurich) 1:1 in sterile saline and loaded it into a Nanoject II or Nanoject III injector (Drummond Scientific). After induction of anesthesia as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... and performed five viral injections at stereotaxic coordinates −2.25 mm lateral and from −0.25 mm to 0.75 mm in 0.25 mm steps anterior to bregma (based on localization of fS1 in mice with intrinsic signal imaging 25) using pulled and beveled (≈25 μm tip diameter) glass pipettes (Wiretroll II, Drummond Scientific). We injected AAV9/2-hSyn1-jGCaMP7f (Zurich Viral Vector Facility ...
-
bioRxiv - Molecular Biology 2023Quote: ... They were injected with 50.6 nL cRNA (concentration 500-550 ng/μL) or nuclease free water using a Nanoinject II (Drummond Scientific Company). Glass capillars for the Nanoinject II were prepare with a needle puller and manually cut with surgical scissors ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Cell Biology 2023Quote: ... WM983B cells of different lysosome clustering status (spread, clustered) were injected with a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) and microforged glass capillaries (25 to 30µm inner diameter ...
-
bioRxiv - Neuroscience 2023Quote: ... were performed using a pulled glass pipette (10–15 µm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Injections were performed at a speed of 23 nl/s ...
-
bioRxiv - Neuroscience 2023Quote: Stereotaxic injections for E-Scope experiments were done using a stereotaxic frame (David Kopf Instruments) and a Nanoject II microinjector (Drummond Scientific). For Miniscope calcium imaging experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial cells and spent culture supernatant samples were injected into Drosophila via the anepisternum (a soft area of the thorax, below the wing) of adult flies using a Nanoject II microinjector (Drummond Scientific) via pulled glass capillary needles.
-
bioRxiv - Immunology 2019Quote: ... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
bioRxiv - Genetics 2020Quote: ... approximately 1 μl of 100 μM siRNA solution was injected into the left side of the thorax using a glass needle and an injector (Nanoject II; Drummond Scientific Company). Immediately after injection ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cold-anesthetized female mosquitoes were microinjected with 2.0 µg gene-specific dsRNA using a Nanoject II microinjector (Drummond Scientific Company, Broomall, PA). Mosquitoes were maintained on 10% sucrose during the experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... 200-300 nl solution containing Adeno-Associated Viruses (AAV) was injected in the cortex of each mouse with a Nano injection pump (Nanoject II, Drummond Scientific Company) with a speed of 30 nl/min ...