Labshake search
Citations for Drummond Scientific :
1 - 50 of 72 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Molecular Biology 2021Quote: ... by a Nanoject 2 (Drummond Scientific). Five ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...
-
bioRxiv - Neuroscience 2023Quote: ... A pulled glass pipette (2-000-001, Drummond Scientific) filled with AAV vector was slowly lowered into the brain with the help of a micropositioner (Model 2650 ...
-
bioRxiv - Neuroscience 2022Quote: ... A small hole was drilled into the skull and 400 nL of 0.9% saline or 0.9% saline + 100 ng/μL recombinant mouse IFN-γ (40 ng IFN-γ total) was injected through a pulled glass pipet using a Nanoject 2000 (Drummond Scientific; 8 pulses of 50 nL). At 5 minutes after injection ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Genetics 2021Quote: ... Five glass capillaries (Drummond Scientific Company, Cat. No. 2-000-001) were filled with 5 μl of 20% sucrose solution in water and inserted into pipet tips on the cap ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Microbiology 2021Quote: ... mosquitoes were injected in the thorax with 414nl of 10mM 2HPCD (this concentration was chosen in line with previously published in vivo experiments in mice and humans (48,49) using Nanoject II (Drummond Scientific, Pennsylvania, USA) hand-held microinjector ...
-
bioRxiv - Immunology 2021Quote: ... Tears were collected using 2 μL sized Microcaps glass capillaries (Drummond Scientific, Broomall, PA) for 5 min after topical stimulation ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was infused at a rate of 2 nL/s using a microinjector (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2021Quote: ... using a vertical micropipette puller (PE-2, Narishige) via an automated injector (Nanoject III, Drummond Scientific). Tracers were injected unilaterally ...
-
bioRxiv - Neuroscience 2022Quote: ... −4.4 DV) at 100nl/min using a glass pipette attached to a microinjector (Nanoject 2, Drummond Scientific). Following viral infusion ...
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... +0.2 and ML: 2.5 and DV: -4.6 & -4.4 relative to bregma using a Nanoject III microinjector (Drummond Scientific, Broomall, PA). 100 µm-core optic fibers (Precision Fiber Products ...
-
bioRxiv - Neuroscience 2022Quote: Injections of 2 mM muscimol in normal saline were performed using the Nanoject III Programmable Nanoliter Injector from Drummond Scientific Company fitted with a borosilicate glass micropipette ...
-
bioRxiv - Microbiology 2023Quote: ... 1-μl capillaries (Microcaps, Drummond Scientific) were heat-sealed at one end and filled with buffer (control ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA complexes were introduced at multiple points between 700-250 μm below the surface of the brain using a Nanoject-2 (Drummond Scientific), culminating in a total injection volume of 10 μl per hemisphere ...
-
bioRxiv - Bioengineering 2020Quote: ... was made and a total of 2 µl of MENPs or MSNPs were injected with a microinjection apparatus Nanoject II (Drummond Scientific). In phase-I in vivo experiment MENPs injection was conducted only in right hemisphere to compare microglia and astrocytes population between injected and intact hemispheres ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were injected with 69 nl of a 2% green fluorescent FluoSpheres solution (in 1X PBS) using a Nanoject III (Drummond Scientific) and incubated at 27°C for 1 h to allow for bead uptake by hemocytes at 10 days post-infection ...
-
bioRxiv - Microbiology 2019Quote: ... a different cohort of females was anaesthetised on ice and injected with 109 FFU/ml of DENV-2 in the thorax using a Nanoject II (Drummond Scientific, USA) hand-held microinjector ...
-
bioRxiv - Neuroscience 2020Quote: ... and -4.5 mm DV) using a 29 G stainless steel cannula connected to a 2 μl Hamilton syringe or a Nanoject system (Drummond Scientific, PA). The injectors were retracted slowly after 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 dpf larval zebrafish were anesthetized and injected directly into the cardiac valley with 2 pg of BefA or negative control vehicle again using the Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company, Broomall, PA) as previously described (Wiles et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... VVF ETH Zurich) 1:1 in sterile saline and loaded it into a Nanoject II or Nanoject III injector (Drummond Scientific). After induction of anesthesia as described above ...
-
bioRxiv - Developmental Biology 2020Quote: ... the tissue was gently aspirated up and down using a micropipette (made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oocytes were injected with 27-54 ng of total mRNA for α, β and γ subunits in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Biophysics 2023Quote: ... Oocytes were injected with 27–54 ng of total mRNA for α, β, and γ subunits (or mutants) in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... diluted 1:100 in PBS using a Nanoject injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... through a glass pipette (PCR Micropipets 1 – 10 ml, Drummond Scientific Company, USA) with a 21 – 27 µm inner tip diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... Injections were done at 1 nL/s with a Nanoject III (Drummond Scientific Company).
-
The Indirect Pathway of the Basal Ganglia Promotes Negative Reinforcement, But Not Motor SuppressionbioRxiv - Neuroscience 2022Quote: ... Virus (Striatum: 0.5-1 μl, GPe: 150 nL) was injected with a Nanoject (Drummond Scientific) through a pulled glass pipet (tip diameter ∼30 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 nL per injection for 120-200K cells total injected) through a beveled Drummond glass micropipette (Drummond Scientific) positioned at 45 degrees from vertical ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.5 mm relative to bregma) at 1 nl/s with a Nanoject III microinjector (Drummond Scientific, PA). Custom-made optic fibers (0.22NA ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass needles were made from 1-mm outer diameter glass pipettes (Wiretrol II, Drummond Scientific Company, Broomall, PA) pulled to a fine tip (20 - 50 µm tip diameter ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...