Labshake search
Citations for Drummond Scientific :
51 - 97 of 97 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade D UG28R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Microbiology 2021Quote: ... mosquitoes were injected in the thorax with 414nl of 10mM 2HPCD (this concentration was chosen in line with previously published in vivo experiments in mice and humans (48,49) using Nanoject II (Drummond Scientific, Pennsylvania, USA) hand-held microinjector ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Biophysics 2019Quote: ... Actin in fiber bundles was decorated with the resulting BSL-RLC-HMM complex by circulating protein samples through a 25 μL glass capillary (Drummond Scientific) containing a tied fiber bundle.
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were injected with 50 nL (12.5 ng of each injected gene) of the desired cRNA subunit and accessory protein combination mix with the NanojectII (Drummond Scientific, USA). Following injection ...
-
bioRxiv - Physiology 2024Quote: ... AedaeItp-l or control Egfp (enhanced green fluorescent protein) dsRNA using a Nanoject III Programmable Nanoliter Injector (Drummond Scientific, Broomall, PA, USA).
-
bioRxiv - Microbiology 2023Quote: ... 1-μl capillaries (Microcaps, Drummond Scientific) were heat-sealed at one end and filled with buffer (control ...
-
bioRxiv - Neuroscience 2022Quote: ... VVF ETH Zurich) 1:1 in sterile saline and loaded it into a Nanoject II or Nanoject III injector (Drummond Scientific). After induction of anesthesia as described above ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oocytes were injected with 27-54 ng of total mRNA for α, β and γ subunits in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Biophysics 2023Quote: ... Oocytes were injected with 27–54 ng of total mRNA for α, β, and γ subunits (or mutants) in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... diluted 1:100 in PBS using a Nanoject injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... through a glass pipette (PCR Micropipets 1 – 10 ml, Drummond Scientific Company, USA) with a 21 – 27 µm inner tip diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... Injections were done at 1 nL/s with a Nanoject III (Drummond Scientific Company).
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.5 mm relative to bregma) at 1 nl/s with a Nanoject III microinjector (Drummond Scientific, PA). Custom-made optic fibers (0.22NA ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass needles were made from 1-mm outer diameter glass pipettes (Wiretrol II, Drummond Scientific Company, Broomall, PA) pulled to a fine tip (20 - 50 µm tip diameter ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 nL of the 2% DiI solution was then slowly injected into either rostral forelimb motor area (RFA) or caudal forelimb motor area (CFA) at 1 nl/sec (Nanoject III, Drummond Scientific). The coordinates for the RFA and CFA in male Long Evans rats were based on previous reports (Brown and Teskey 2014 ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus was delivered at a speed of 46 nl s−1 into the thorax using a pulled glass capillary needle and a manual microinjector (Nanoject II; Drummond Scientific). This controlled the infection dose by removing the variation that would have resulted from oral feeding ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... then injected into target brain coordinates at the rate of 1 nL per second using a Nanoject III programmable injector (Drummond Scientific). Target brain coordinates (relative to bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Three doses of 32.2 nl (at 1 mg/mL) were delivered each day using a Nanoject II (Drummond Scientific Broomall, PA, USA). The head and tail of the animal was amputated on the fourth day ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Physiology 2021Quote: ... Oocytes were injected with 18.4 ng of ayRhp1 cRNA (36.8 nL with 0.5 ng nl−1) (ayRhp1) or equivalent volume of nuclease-free water (control) using a Nanoject II or III auto-nanoliter injector (Drummond Scientific, Broomall, PA, USA). Experiments were conducted three days post-injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Microinjections were performed with a 1 µL Neuros Hamilton syringe (Hamilton, Reno, NV, USA) and a micro-infusion pump (Nanoject III, Drummond Scientific; Broomall, PA, USA) that infused virus at 100 nL/min ...
-
bioRxiv - Neuroscience 2023Quote: ... at the titer of 1×1012 vg/ml in a total of 150 nl in the aid of nanoliter injector (Nanoject III, Drummond scientific, USA, Catalog #68018).
-
bioRxiv - Physiology 2023Quote: ... blood was collected from a small incision in the vena cava using a capillary tube (Hemato-Clad™, Drummond Scientific Company, #1-00-7500-HC/5, Broomall, PA). Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825 ...