Labshake search
Citations for Drummond Scientific :
51 - 58 of 58 citations for Dengue Virus Serotype 4 VLP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...