Labshake search
Citations for Drummond Scientific :
1 - 50 of 133 citations for 8 HYDROXY 1 3 DIOXOLO 4 5 G QUINOLINE 7 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2020Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2022Quote: ... and glass capillaries (3-000-203-G/X, Drummond Scientific) backfilled with mineral oil ...
-
bioRxiv - Neuroscience 2023Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2020Quote: ... The glass pipette (#3-000-203-G/X; Drummond Scientific, Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipette (Drummond Scientific #3-000-203-G/X; Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Immunology 2022Quote: Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass capillary used for injections (catalog # 3-000-203-G/X, Drummond Scientific) were pulled with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... a glass pipette (3-000-203-G/X, Drummond Scientific Company, PA, USA) was pulled ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass capillary tube (model #3-000-203-G, Drummond Scientific Company, Broomall PA) was backfilled with mineral oil before being loaded into a Nanoject III injector (model #3-000-207 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.53 mm inner diameter capillary glass (cat# 3-000-203-G/X, Drummond Scientific Company) with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.53 mm inner diameter capillary glass (cat# 3-000-203-G/X, Drummond Scientific Company) with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2024Quote: ... Injection pipettes were prepared from glass capillaries (catalog # 3-000-203-G/X, Drummond Scientific) pulled with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2019Quote: ... we used capillary glass tubes (3.5” #3-000-203-G/X, Drummond Scientific Co, PA, USA), pulled using a P-97 pipette puller (Sutter Instruments ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus was injected with needles pulled from capillary glass (3-000-203-G/X, Drummond Scientific) at a flow rate of 2nl/s using a micropump (Nanoject III ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipettes (1.14 mm outer diameter and 0.53 mm inner diameter, 3-000-203-G/X, Drummond Scientific, PA) were pulled on a P-97 Flaming/Brown type micropipette puller (Sutter Instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Ten or twenty nL of undiluted viral solution were delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... A recombinant viral vector was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
bioRxiv - Neuroscience 2021Quote: ... was microinjected through micropipettes with ~10-μm Ø pulled from thinwalled borosilicate glass capillaries (outer Ø: 1.14 mm, inner Ø: 0.53 mm; 3-000-203-G/X, Drummond Scientific) using a vertical micropipette puller (PE-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... of CAV-2-Cre using pipettes with long taper tips pulled from borosilicate capillaries (3.5” Drummond # 3-000-203-G/X, Drummond Scientific, PA). For two-photon imaging experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected in the proximity of the site of injury by electrical micro-injector (BJ110, BEX CO., LTD.) through glass capillaries (3-000-203-G/X, Drummond Scientific Company). Following injection ...
-
bioRxiv - Bioengineering 2022Quote: ... After the dura was removed the flexiLiTE optoelectrode was inserted into the brain (1.2 mm depth from the surface of the brain) using a glass pipette with a tip diameter of 15-20 μm (3-000-203-G/X, Drummond Scientific, PA). The glass pipette was retracted ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... into each side of the midline guided by ultrasound backscatter microscopy (VisualSonics, Vevo 3100) via a pulled glass micropipette (Drummond Scientific, 3-000-203-G/X) with a digitally-controlled ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... DV: -4.5 mm from brain surface) using either a Hamilton syringe (5 µL) or Nanoject (Drummond Scientific; Part number: 3-000-207).
-
bioRxiv - Neuroscience 2023Quote: ... The viral construct AAV5-DIO-CaMKIIa-hChR2(H134R)-eYFP (Neurophotonics, 5.0x1012 GC/ml) was microinfused using a Nanoject II injector and glass micropipette (Drummond Scientific, 3-000-203-G/X, 10 μm tip) in the ventral tegmental area (10° angle ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Neuroscience 2023Quote: ... The acid was injected using a Nanojet II (Drummond Scientific Company). Animals were anesthetized with isoflurane (anesthesia induced at 5% concentration and maintenance below 3%) ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2023Quote: ... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
bioRxiv - Neuroscience 2023Quote: ... A Nanoinject III (Drummond Scientific, 3-000-207) was used to deliver either 250-300 nL of the retrograde tracer Fast DiI oil (2.5 mg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Neuroscience 2021Quote: ... and mounted in a NanoJect 3 (Drummond Scientific, USA). The pipette was front loaded with the virus solution and 150 nL injected at a depth of 350-500 μm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... using a Nanoject 3 system (Drummond Scientific Company, PA) (500 nl ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Cancer Biology 2024Quote: Nanoject III Injector (Drummond Scientific Company; CA#3-000-207)