Labshake search
Citations for Drummond Scientific :
1 - 50 of 71 citations for 8 4 dimethylaminophenyl diazenyl N N dimethyl 10 phenylphenazin 10 ium 2 amine chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Immunology 2022Quote: ... 10 μL of whole blood was collected with a microcapillary (Drummond Scientific), and the sample was then immediately dispensed into 90 μL Reagent E buffer (Gyros ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 sec delay between 10 nl injection cycles (Nanoject III, Drummond Scientific) using pulled glass pipets (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... through a glass pipette (PCR Micropipets 1 – 10 ml, Drummond Scientific Company, USA) with a 21 – 27 µm inner tip diameter ...
-
bioRxiv - Cell Biology 2023Quote: ... All viruses were infused slowly for over 10 minutes using Nanoject (Drummond Scientific) connected to a glass pipette ...
-
bioRxiv - Neuroscience 2021Quote: ... delivered via pulled glass pipettes (5μl, Drummond Scientific, PA, USA; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2022Quote: All viruses were infused slowly for over 10 min using a Nanoject (Drummond Scientific) connected to a glass pipette ...
-
bioRxiv - Neuroscience 2023Quote: ... A glass needle pulled from a Wiretrol 10 µl capillary micropipette (Drummond Scientific, 21-175B) was inserted from the dorsal side into the hindbrain at a 45° angle to the body axis at the level of the vagus nucleus ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass needle pulled from a Wiretrol 10 µl capillary micropipette (Drummond Scientific, 21-175B) was filled with mineral oil (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Using a glass pipette (tip diameter of ~10 μm) coupled to a Nanoject II (Drummond scientific, PA, USA), we administered 27 microinjections of 36.8 nL each (23 nL/second ...
-
bioRxiv - Neuroscience 2021Quote: ... fluorescently conjugated tracers (10 mg/ml) were injected into the cardiac sac using Nanoject II (Drummond Scientific, Broomall, PA). Larvae were then mounted with 1.5% low gelling agarose (Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: ... fluorescently conjugated tracers (10 mg/ml) were injected into the cardiac sac using Nanoject II (Drummond Scientific, Broomall, PA). Embryos were then mounted with 1.5% low gelling agarose (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... with 4.6 nL of TRIS (10 mM pH7.5) or DCV (500PFU) by intrathoracic injection (Nanoject II apparatus; Drummond Scientific). Flies were kept at 25°C for either 2 or 3 days ...
-
bioRxiv - Neuroscience 2022Quote: ... A volume of ∼0.12 μL of microspheres was pressure-injected (25 psi, 10–15 ms duration) from capillary pipettes (Drummond Scientific) with a Picospritzer (Parker–Hannifin) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Microinjections were completed with 10 μL Hamilton microsyringe filled with mineral oil and with a glass micropipette (Drummond Scientific Company) filled with mineral oil attached ...
-
bioRxiv - Neuroscience 2020Quote: ... Injections were performed using a pulled glass pipette (10 –15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Each individual injection was performed at a speed of 23 nL/s ...
-
bioRxiv - Neuroscience 2019Quote: ... Unilateral injections were performed using a pulled glass pipette (10-15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Approximately 30 nl of virus was deposited at each injection site at 1-2 minute intervals (from bregma in mm ...
-
bioRxiv - Genetics 2021Quote: Three- to five-day-old female adults were injected with 50 nl of 10 mM adenosine solution using a NANOJECT II (Drummond Scientific); control flies were injected with 50 nl of 1× PBS ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... into the ventral side of the thorax between its legs using 10 ml borosilicate capillary tubes (Fisher) fitted onto an aspirator (Drummond Scientific). Whereas for B ...
-
bioRxiv - Neuroscience 2023Quote: ... were performed using a pulled glass pipette (10–15 µm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Injections were performed at a speed of 23 nl/s ...
-
bioRxiv - Neuroscience 2021Quote: ... vector core) using sterile glass micropipettes (10-20μm diameter) attached to a partially automated microinjection device (Nanoject III Microinjector, Drummond Scientific; Broomall, PA). The micropipettes were slowly lowered into BLA at 4.6 mm then 4.3 mm from the dura ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Neuroscience 2022Quote: ... The skull was gently drilled and 10 nL of a viral solution were injected (Nanoject III, Drummond Scientific, rate of 5 nL/min) at a depth of 1.25 mm below the dura.
-
bioRxiv - Neuroscience 2024Quote: ... Mice were head-fixed on a platform and the B2 whisker was inserted inside a glass capillary tube (Wiretrol® II 5 & 10 uL, Drummond Scientific Company) placed 2mm away from the mouse’s snout ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oocytes were injected with 27-54 ng of total mRNA for α, β and γ subunits in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Oocytes were microinjected with 10 ng of in vitro synthesized mRNA (0.2 ng/μL) using an automatic oocyte injector (Nanoject II™; Drummond Scientific Co., Broomall, PA) up to 48 hours after isolation ...
-
bioRxiv - Neuroscience 2020Quote: ... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
bioRxiv - Biophysics 2023Quote: ... Oocytes were injected with 27–54 ng of total mRNA for α, β, and γ subunits (or mutants) in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Biophysics 2020Quote: ... Oocytes were microinjected with 10 ng of in vitro synthesized cRNA (200 ng/μL) using an automatic oocyte injector (Nanoject II™; Drummond Scientific Co., Broomall, PA). Depending on the construct injected ...
-
bioRxiv - Microbiology 2022Quote: ... and zygote suspensions was injected into the hemocoel of <10-day-old male and female mosquitoes using a Nanoject II automatic nanoliter injector (Drummond Scientific Company, Broomall, PA, USA) [11].
-
bioRxiv - Neuroscience 2021Quote: ... A small hole was drilled into the skull and 230 nL of virus (see titer above) was injected through a pulled glass pipet using a Nanoject 2000 (Drummond Scientific; 10 pulses of 23 nL). At 5 minutes after injection ...
-
bioRxiv - Neuroscience 2023Quote: ... The viral construct AAV5-DIO-CaMKIIa-hChR2(H134R)-eYFP (Neurophotonics, 5.0x1012 GC/ml) was microinfused using a Nanoject II injector and glass micropipette (Drummond Scientific, 3-000-203-G/X, 10 μm tip) in the ventral tegmental area (10° angle ...
-
bioRxiv - Molecular Biology 2021Quote: ... by a Nanoject 2 (Drummond Scientific). Five ...
-
bioRxiv - Neuroscience 2023Quote: ... A pulled glass pipette (2-000-001, Drummond Scientific) filled with AAV vector was slowly lowered into the brain with the help of a micropositioner (Model 2650 ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Genetics 2021Quote: ... Five glass capillaries (Drummond Scientific Company, Cat. No. 2-000-001) were filled with 5 μl of 20% sucrose solution in water and inserted into pipet tips on the cap ...
-
bioRxiv - Neuroscience 2022Quote: ... A small hole was drilled into the skull and 400 nL of 0.9% saline or 0.9% saline + 100 ng/μL recombinant mouse IFN-γ (40 ng IFN-γ total) was injected through a pulled glass pipet using a Nanoject 2000 (Drummond Scientific; 8 pulses of 50 nL). At 5 minutes after injection ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Immunology 2021Quote: ... Tears were collected using 2 μL sized Microcaps glass capillaries (Drummond Scientific, Broomall, PA) for 5 min after topical stimulation ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was infused at a rate of 2 nL/s using a microinjector (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2021Quote: ... using a vertical micropipette puller (PE-2, Narishige) via an automated injector (Nanoject III, Drummond Scientific). Tracers were injected unilaterally ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...