Labshake search
Citations for Drummond Scientific :
51 - 64 of 64 citations for 7 Trifluoromethyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... then injected into target brain coordinates at the rate of 1 nL per second using a Nanoject III programmable injector (Drummond Scientific). Target brain coordinates (relative to bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Three doses of 32.2 nl (at 1 mg/mL) were delivered each day using a Nanoject II (Drummond Scientific Broomall, PA, USA). The head and tail of the animal was amputated on the fourth day ...
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Physiology 2021Quote: ... Oocytes were injected with 18.4 ng of ayRhp1 cRNA (36.8 nL with 0.5 ng nl−1) (ayRhp1) or equivalent volume of nuclease-free water (control) using a Nanoject II or III auto-nanoliter injector (Drummond Scientific, Broomall, PA, USA). Experiments were conducted three days post-injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Microinjections were performed with a 1 µL Neuros Hamilton syringe (Hamilton, Reno, NV, USA) and a micro-infusion pump (Nanoject III, Drummond Scientific; Broomall, PA, USA) that infused virus at 100 nL/min ...
-
bioRxiv - Neuroscience 2023Quote: ... at the titer of 1×1012 vg/ml in a total of 150 nl in the aid of nanoliter injector (Nanoject III, Drummond scientific, USA, Catalog #68018).
-
bioRxiv - Physiology 2023Quote: ... blood was collected from a small incision in the vena cava using a capillary tube (Hemato-Clad™, Drummond Scientific Company, #1-00-7500-HC/5, Broomall, PA). Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825 ...