Labshake search
Citations for Drummond Scientific :
1 - 50 of 101 citations for 7 CHLORO 3 1 METHYL 4 PIPERIDINYL INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2023Quote: ... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
bioRxiv - Neuroscience 2023Quote: ... A Nanoinject III (Drummond Scientific, 3-000-207) was used to deliver either 250-300 nL of the retrograde tracer Fast DiI oil (2.5 mg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Neuroscience 2021Quote: ... and mounted in a NanoJect 3 (Drummond Scientific, USA). The pipette was front loaded with the virus solution and 150 nL injected at a depth of 350-500 μm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... using a Nanoject 3 system (Drummond Scientific Company, PA) (500 nl ...
-
bioRxiv - Neuroscience 2019Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2020Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2022Quote: ... and glass capillaries (3-000-203-G/X, Drummond Scientific) backfilled with mineral oil ...
-
bioRxiv - Neuroscience 2023Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Cancer Biology 2024Quote: Nanoject III Injector (Drummond Scientific Company; CA#3-000-207)
-
bioRxiv - Neuroscience 2023Quote: ... Viral vectors were delivered using Nanoject 3 (Drummond Scientific, Broomall, PA). The needle was held in place for >5 min after infusion at each DV ...
-
bioRxiv - Immunology 2019Quote: ... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2020Quote: ... The glass pipette (#3-000-203-G/X; Drummond Scientific, Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipette (Drummond Scientific #3-000-203-G/X; Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Immunology 2022Quote: Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2022Quote: ... was injected with Nanoject-III (Drummond Scientific Company, model #3-000-207) at a depth of 200 μm beneath pia surface and virus was slowly injected at 4-5 sites ~1 to 4 mm lateral to midline of skull ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass capillary used for injections (catalog # 3-000-203-G/X, Drummond Scientific) were pulled with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... a glass pipette (3-000-203-G/X, Drummond Scientific Company, PA, USA) was pulled ...
-
bioRxiv - Neuroscience 2020Quote: ... and adeno-associated virus (AAV) particles were injected with a Nanoject 3 (Drummond scientific) at a speed of 1 nl/sec for 30 secs injection with 30 secs pause for a total 33 cycles (i.e. ...
-
bioRxiv - Neuroscience 2019Quote: ... using a pressure injection system (Nanoject II, Drummond Scientific Company, Catalog# 3-000-204). To mark the injection site ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass capillary tube (model #3-000-203-G, Drummond Scientific Company, Broomall PA) was backfilled with mineral oil before being loaded into a Nanoject III injector (model #3-000-207 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.53 mm inner diameter capillary glass (cat# 3-000-203-G/X, Drummond Scientific Company) with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.53 mm inner diameter capillary glass (cat# 3-000-203-G/X, Drummond Scientific Company) with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2024Quote: ... Injection pipettes were prepared from glass capillaries (catalog # 3-000-203-G/X, Drummond Scientific) pulled with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2019Quote: ... we used capillary glass tubes (3.5” #3-000-203-G/X, Drummond Scientific Co, PA, USA), pulled using a P-97 pipette puller (Sutter Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... Injections were performed with a glass pipette mounted in a Nanoject 3 infusion system (Drummond Scientific). 500 nL of virus AAV1-Syn-GCaMP6s AAV2/9-CAG-FLEX-GCaMP6m-WPRE.SV40 (1.37 × 1012 genome copies (GC ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus was injected with needles pulled from capillary glass (3-000-203-G/X, Drummond Scientific) at a flow rate of 2nl/s using a micropump (Nanoject III ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2019Quote: ... or a 1:1 mix of AAV9.CamKII0.4.Cre.SV40 and either AAV9.CAG.Flex.GCaMP6f.WPRE.SV40 or AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 was injected using an oil-based pressure injection system (Nanoject 3, Drummond Scientific). After injections ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... Each fly was injected with 50 nl of 3 mM paraquat ringer solution using a NANOJECT II (Drummond Scientific). Control flies were injected with ringer buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipettes (1.14 mm outer diameter and 0.53 mm inner diameter, 3-000-203-G/X, Drummond Scientific, PA) were pulled on a P-97 Flaming/Brown type micropipette puller (Sutter Instrument ...
-
bioRxiv - Physiology 2021Quote: ... The oocytes were pressure-injected using a Nanoject variable microinjection apparatus (model mo. 3-000-203, Drummond Scientific, Broomal, PA) with 0.05 – 500 ng/μl of connexin cRNA along with 5 ng/36.8 nl of oligonucleotide antisense to mRNA for Xenopus Cx38 to prevent contamination by endogenous connexin hemichannel currents [25] ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... Ten or twenty nL of undiluted viral solution were delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... A recombinant viral vector was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... was microinjected through micropipettes with ~10-μm Ø pulled from thinwalled borosilicate glass capillaries (outer Ø: 1.14 mm, inner Ø: 0.53 mm; 3-000-203-G/X, Drummond Scientific) using a vertical micropipette puller (PE-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... of CAV-2-Cre using pipettes with long taper tips pulled from borosilicate capillaries (3.5” Drummond # 3-000-203-G/X, Drummond Scientific, PA). For two-photon imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected into two coordinates in the target brain region at a speed of 60 nl/min using Nanoject 3 pump (Drummond Scientific). The following coordinates were used [Distance in millimeters from the Bregma for the anterior (A)-posterior (P ...
-
bioRxiv - Neuroscience 2024Quote: The AAV vectors were injected through a pulled-glass pipette and the nanoliter injector (Nanoject III, Drummond Scientific −3-000-207). The injection was performed using a small-animal stereotaxic instrument (David Kopf Instruments ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...