Labshake search
Citations for Drummond Scientific :
51 - 100 of 103 citations for 6 Phenyl piperidine 1 3 dicarboxylic acid 1 tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Virus was injected with needles pulled from capillary glass (3-000-203-G/X, Drummond Scientific) at a flow rate of 2nl/s using a micropump (Nanoject III ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.5 mm relative to bregma) at 1 nl/s with a Nanoject III microinjector (Drummond Scientific, PA). Custom-made optic fibers (0.22NA ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass needles were made from 1-mm outer diameter glass pipettes (Wiretrol II, Drummond Scientific Company, Broomall, PA) pulled to a fine tip (20 - 50 µm tip diameter ...
-
bioRxiv - Neuroscience 2019Quote: ... or a 1:1 mix of AAV9.CamKII0.4.Cre.SV40 and either AAV9.CAG.Flex.GCaMP6f.WPRE.SV40 or AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 was injected using an oil-based pressure injection system (Nanoject 3, Drummond Scientific). After injections ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was injected with a bevelled micropipette using a Nanoject II injector (Drummond Scientific Company, Broomall, PA 1) attached to a stereotaxic micromanipulator ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Genetics 2021Quote: ... Each fly was injected with 50 nl of 3 mM paraquat ringer solution using a NANOJECT II (Drummond Scientific). Control flies were injected with ringer buffer ...
-
bioRxiv - Genetics 2019Quote: ... was injected into the thorax of cold-anesthetized 1 d-old female mosquitoes using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific). Mosquitoes were injected with dsRNA specific for the target gene ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 nL of the 2% DiI solution was then slowly injected into either rostral forelimb motor area (RFA) or caudal forelimb motor area (CFA) at 1 nl/sec (Nanoject III, Drummond Scientific). The coordinates for the RFA and CFA in male Long Evans rats were based on previous reports (Brown and Teskey 2014 ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus was delivered at a speed of 46 nl s−1 into the thorax using a pulled glass capillary needle and a manual microinjector (Nanoject II; Drummond Scientific). This controlled the infection dose by removing the variation that would have resulted from oral feeding ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... then injected into target brain coordinates at the rate of 1 nL per second using a Nanoject III programmable injector (Drummond Scientific). Target brain coordinates (relative to bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipettes (1.14 mm outer diameter and 0.53 mm inner diameter, 3-000-203-G/X, Drummond Scientific, PA) were pulled on a P-97 Flaming/Brown type micropipette puller (Sutter Instrument ...
-
bioRxiv - Physiology 2021Quote: ... The oocytes were pressure-injected using a Nanoject variable microinjection apparatus (model mo. 3-000-203, Drummond Scientific, Broomal, PA) with 0.05 – 500 ng/μl of connexin cRNA along with 5 ng/36.8 nl of oligonucleotide antisense to mRNA for Xenopus Cx38 to prevent contamination by endogenous connexin hemichannel currents [25] ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... Ten or twenty nL of undiluted viral solution were delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... A recombinant viral vector was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Three doses of 32.2 nl (at 1 mg/mL) were delivered each day using a Nanoject II (Drummond Scientific Broomall, PA, USA). The head and tail of the animal was amputated on the fourth day ...
-
bioRxiv - Neuroscience 2021Quote: ... was microinjected through micropipettes with ~10-μm Ø pulled from thinwalled borosilicate glass capillaries (outer Ø: 1.14 mm, inner Ø: 0.53 mm; 3-000-203-G/X, Drummond Scientific) using a vertical micropipette puller (PE-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... of CAV-2-Cre using pipettes with long taper tips pulled from borosilicate capillaries (3.5” Drummond # 3-000-203-G/X, Drummond Scientific, PA). For two-photon imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected into two coordinates in the target brain region at a speed of 60 nl/min using Nanoject 3 pump (Drummond Scientific). The following coordinates were used [Distance in millimeters from the Bregma for the anterior (A)-posterior (P ...
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Neuroscience 2024Quote: The AAV vectors were injected through a pulled-glass pipette and the nanoliter injector (Nanoject III, Drummond Scientific −3-000-207). The injection was performed using a small-animal stereotaxic instrument (David Kopf Instruments ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Neuroscience 2020Quote: ... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected in the proximity of the site of injury by electrical micro-injector (BJ110, BEX CO., LTD.) through glass capillaries (3-000-203-G/X, Drummond Scientific Company). Following injection ...
-
bioRxiv - Bioengineering 2022Quote: ... After the dura was removed the flexiLiTE optoelectrode was inserted into the brain (1.2 mm depth from the surface of the brain) using a glass pipette with a tip diameter of 15-20 μm (3-000-203-G/X, Drummond Scientific, PA). The glass pipette was retracted ...
-
bioRxiv - Neuroscience 2023Quote: ... DV: -4.5 mm from brain surface) using either a Hamilton syringe (5 µL) or Nanoject (Drummond Scientific; Part number: 3-000-207).
-
bioRxiv - Physiology 2021Quote: ... Oocytes were injected with 18.4 ng of ayRhp1 cRNA (36.8 nL with 0.5 ng nl−1) (ayRhp1) or equivalent volume of nuclease-free water (control) using a Nanoject II or III auto-nanoliter injector (Drummond Scientific, Broomall, PA, USA). Experiments were conducted three days post-injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Microinjections were performed with a 1 µL Neuros Hamilton syringe (Hamilton, Reno, NV, USA) and a micro-infusion pump (Nanoject III, Drummond Scientific; Broomall, PA, USA) that infused virus at 100 nL/min ...
-
bioRxiv - Neuroscience 2023Quote: ... at the titer of 1×1012 vg/ml in a total of 150 nl in the aid of nanoliter injector (Nanoject III, Drummond scientific, USA, Catalog #68018).
-
bioRxiv - Cell Biology 2023Quote: ... 10 ∼ 0.8-1cm long planarians were injected 3 consecutive days with 20-50 ng dsRNA per injection using a Nanoject II injector (Drummond Scientific, Broomall, PA). The animals were then amputated from their head and tail at day 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... The tracer was delivered using a pulled glass pipette (tip diameter = 40– 60 μm) at a rate of 50 nl min with a Nanojet 3 (Drummond Scientific Company, Broomall, PA). The pipette was left in the brain for 15 min after completion of the injection to prevent backflow ...
-
bioRxiv - Neuroscience 2020Quote: ... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
bioRxiv - Developmental Biology 2020Quote: ... loaded into a fine glass needle and implanted into the abdomen of female host w1118 flies using a nanoinjector (Nanoject II Auto-Nanoliter Injector, Drummond Scientific Company, 3-000-205A). Host flies carrying allografts were kept at 25°C and examined daily for the presence of GFP in their abdomen and other tissues ...
-
bioRxiv - Neuroscience 2021Quote: ... into each side of the midline guided by ultrasound backscatter microscopy (VisualSonics, Vevo 3100) via a pulled glass micropipette (Drummond Scientific, 3-000-203-G/X) with a digitally-controlled ...