Labshake search
Citations for Drummond Scientific :
51 - 100 of 105 citations for 6 Hydroxy 5H pyrrolo 3 4 b pyridine 5 7 6H dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2019Quote: ... or a 1:1 mix of AAV9.CamKII0.4.Cre.SV40 and either AAV9.CAG.Flex.GCaMP6f.WPRE.SV40 or AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 was injected using an oil-based pressure injection system (Nanoject 3, Drummond Scientific). After injections ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... on ice and then aspirated into a micropipette (Drummond Scientific, 5-000-2010). A small incision was made near the kidney pole to separate the capsule from the renal parenchyma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and a beveled glass pipette (Wiretrol II, 5-000-2010, Drummond Scientific Company) back-filled with mineral oil and front-filled with the material to be injected was slowly inserted into a target coordinate ...
-
bioRxiv - Neuroscience 2021Quote: ... was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2019Quote: ... Viruses were front-filled into a pulled glass pipette (Drummond Scientific, #5-000-2005) filled with mineral oil (Millipore Sigma ...
-
bioRxiv - Genetics 2021Quote: ... Each fly was injected with 50 nl of 3 mM paraquat ringer solution using a NANOJECT II (Drummond Scientific). Control flies were injected with ringer buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... using a pulled glass pipette (5 μl PCR Pipets, Drummond Scientific Co, Broomall, PA, USA) attached to a Hamilton microliter syringe (Hamilton Bonaduz AG ...
-
bioRxiv - Neuroscience 2020Quote: ... and a glass pipette (Wiretrol II #5-000-2005, Drummond Scientific Company, Broomall, PA, USA), pulled to have an outer diameter of 60-90μm at the tip ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipettes (1.14 mm outer diameter and 0.53 mm inner diameter, 3-000-203-G/X, Drummond Scientific, PA) were pulled on a P-97 Flaming/Brown type micropipette puller (Sutter Instrument ...
-
bioRxiv - Physiology 2021Quote: ... The oocytes were pressure-injected using a Nanoject variable microinjection apparatus (model mo. 3-000-203, Drummond Scientific, Broomal, PA) with 0.05 – 500 ng/μl of connexin cRNA along with 5 ng/36.8 nl of oligonucleotide antisense to mRNA for Xenopus Cx38 to prevent contamination by endogenous connexin hemichannel currents [25] ...
-
bioRxiv - Neuroscience 2022Quote: ... Ten or twenty nL of undiluted viral solution were delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... A recombinant viral vector was delivered using a glass pipette pulled from borosilicate glass (3.5” 3-000-203-G/X, Drummond Scientific) and connected to a Nanoject III system (Drummond Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... glass needles were created by pulling Wiretrol II capillaries (Drummond Scientific Company, cat. #5-000-2005) using a needle puller (Sutter Instrument ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Neuroscience 2021Quote: ... was microinjected through micropipettes with ~10-μm Ø pulled from thinwalled borosilicate glass capillaries (outer Ø: 1.14 mm, inner Ø: 0.53 mm; 3-000-203-G/X, Drummond Scientific) using a vertical micropipette puller (PE-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... of CAV-2-Cre using pipettes with long taper tips pulled from borosilicate capillaries (3.5” Drummond # 3-000-203-G/X, Drummond Scientific, PA). For two-photon imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2023Quote: ... was injected into two coordinates in the target brain region at a speed of 60 nl/min using Nanoject 3 pump (Drummond Scientific). The following coordinates were used [Distance in millimeters from the Bregma for the anterior (A)-posterior (P ...
-
bioRxiv - Neuroscience 2024Quote: The AAV vectors were injected through a pulled-glass pipette and the nanoliter injector (Nanoject III, Drummond Scientific −3-000-207). The injection was performed using a small-animal stereotaxic instrument (David Kopf Instruments ...
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected in the proximity of the site of injury by electrical micro-injector (BJ110, BEX CO., LTD.) through glass capillaries (3-000-203-G/X, Drummond Scientific Company). Following injection ...
-
bioRxiv - Bioengineering 2022Quote: ... After the dura was removed the flexiLiTE optoelectrode was inserted into the brain (1.2 mm depth from the surface of the brain) using a glass pipette with a tip diameter of 15-20 μm (3-000-203-G/X, Drummond Scientific, PA). The glass pipette was retracted ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 ∼ 0.8-1cm long planarians were injected 3 consecutive days with 20-50 ng dsRNA per injection using a Nanoject II injector (Drummond Scientific, Broomall, PA). The animals were then amputated from their head and tail at day 4 ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2021Quote: ... The tracer was delivered using a pulled glass pipette (tip diameter = 40– 60 μm) at a rate of 50 nl min with a Nanojet 3 (Drummond Scientific Company, Broomall, PA). The pipette was left in the brain for 15 min after completion of the injection to prevent backflow ...
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Developmental Biology 2020Quote: ... loaded into a fine glass needle and implanted into the abdomen of female host w1118 flies using a nanoinjector (Nanoject II Auto-Nanoliter Injector, Drummond Scientific Company, 3-000-205A). Host flies carrying allografts were kept at 25°C and examined daily for the presence of GFP in their abdomen and other tissues ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Neuroscience 2021Quote: ... into each side of the midline guided by ultrasound backscatter microscopy (VisualSonics, Vevo 3100) via a pulled glass micropipette (Drummond Scientific, 3-000-203-G/X) with a digitally-controlled ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV viruses containing double floxed ChR2 construct (5 nl) were microinjected to the septal tissue with a micro injector (Drummond Scientific) on the second day of culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Neuroscience 2024Quote: ... Zürich) at an injection rate of 50-100 nL/min using a thin glass pipette (5-000-1001-X, Drummond Scientific) pulled on a vertical puller (Narishige PP-830) ...
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Neuroscience 2022Quote: ... Injections (0.75 ul/hemisphere) were performed over a period of 5 minutes (0.15 ul/minute) using a Nanoject II (Drummond Scientific, Broomall, PA) and injectors were left in place for 5 minutes to facilitate viral diffusion from the injection site ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were injected with 50 nL (12.5 ng of each injected gene) of the desired cRNA subunit and accessory protein combination mix with the NanojectII (Drummond Scientific, USA). Following injection ...
-
bioRxiv - Neuroscience 2024Quote: ... Virus was injected bilaterally in the DMS or DLS at 4.6 nL/5 seconds (9 minutes) using a borosilicate pipette (Drummond scientific, >25 µm) coupled to a nanoinjector (Nanoject II Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... The viral construct AAV5-DIO-CaMKIIa-hChR2(H134R)-eYFP (Neurophotonics, 5.0x1012 GC/ml) was microinfused using a Nanoject II injector and glass micropipette (Drummond Scientific, 3-000-203-G/X, 10 μm tip) in the ventral tegmental area (10° angle ...