Labshake search
Citations for Drummond Scientific :
1 - 50 of 79 citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Genetics 2019Quote: ... Cold-anesthetized 5-6 day-old females were injected into their thorax using a nanoinjector (Nanoject II, Drummond Scientific) with 69 nL of bacteria or 138 nL of fluorescent beads ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Molecular Biology 2021Quote: ... by a Nanoject 2 (Drummond Scientific). Five ...
-
bioRxiv - Neuroscience 2021Quote: ... glass micropipettes (Drummond Scientific, 5-000-1001-X10), as previously described (Mohan et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... A glass pipette containing the 6-OHDA solution or vehicle secured to a Nanoject (Drummond Scientific, Broomall, PA) was then lowered through the burr holes to a depth of 5.8 mm below the brain surface ...
-
bioRxiv - Neuroscience 2023Quote: Glass pipettes (Wiretrol II, Drummond Scientific Company, 5-000-2010) with a long taper (more than 6 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... connected to a glass pipette (Drummond Scientific, 5-000-2005) pulled to a 30 µm tip (Sutter Instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... A Wiretrol II glass pipette (Drummond Scientific Company, 5-0002010), pulled to give a sharp tip (Sutter ...
-
bioRxiv - Neuroscience 2023Quote: ... and pulled glass electrodes (Drummond Scientific Company, 5-000-2005). 400 nl of virus was injected at a rate of 40 nl/min ...
-
bioRxiv - Bioengineering 2023Quote: Glass pipettes (5-000-1010, DRUMMOND WIRETROL, Drummond Scientific Co.) were pulled on a Model P-97 (Sutter Instrument Co.) ...
-
bioRxiv - Neuroscience 2023Quote: ... A pulled glass pipette (2-000-001, Drummond Scientific) filled with AAV vector was slowly lowered into the brain with the help of a micropositioner (Model 2650 ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of ∼240 nL (41.4 nL x 6 at 23 nL/sec) was pressure-injected on each side using the Nanoject II (Drummond Scientific Company). The pipette was held in place for 5 minutes after injection to allow diffusion before being slowly retracted from the brain ...
-
bioRxiv - Microbiology 2021Quote: ... 18.6 nL of the mixture was injected into the second-instar nymph using a Nanoinject II auto-nanoliter injector (Drummond Scientific). The injected nymphs were reared on fresh rice seedlings and photographed with an Olympus stereomicroscope SEX16 (Olympus ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 µl of viral particles (VP) with a titre of > 6×106 VP/mL where injected per hemisphere with a Nanoject V2 (Drummond Scientific Co ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 sec delay between 10 nl injection cycles (Nanoject III, Drummond Scientific) using pulled glass pipets (Drummond Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Genetics 2021Quote: ... Five glass capillaries (Drummond Scientific Company, Cat. No. 2-000-001) were filled with 5 μl of 20% sucrose solution in water and inserted into pipet tips on the cap ...
-
bioRxiv - Developmental Biology 2020Quote: ... on ice and then aspirated into a micropipette (Drummond Scientific, 5-000-2010). A small incision was made near the kidney pole to separate the capsule from the renal parenchyma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and a beveled glass pipette (Wiretrol II, 5-000-2010, Drummond Scientific Company) back-filled with mineral oil and front-filled with the material to be injected was slowly inserted into a target coordinate ...
-
bioRxiv - Neuroscience 2019Quote: ... Viruses were front-filled into a pulled glass pipette (Drummond Scientific, #5-000-2005) filled with mineral oil (Millipore Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... using a pulled glass pipette (5 μl PCR Pipets, Drummond Scientific Co, Broomall, PA, USA) attached to a Hamilton microliter syringe (Hamilton Bonaduz AG ...
-
bioRxiv - Neuroscience 2020Quote: ... and a glass pipette (Wiretrol II #5-000-2005, Drummond Scientific Company, Broomall, PA, USA), pulled to have an outer diameter of 60-90μm at the tip ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... glass needles were created by pulling Wiretrol II capillaries (Drummond Scientific Company, cat. #5-000-2005) using a needle puller (Sutter Instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Immunology 2021Quote: ... Tears were collected using 2 μL sized Microcaps glass capillaries (Drummond Scientific, Broomall, PA) for 5 min after topical stimulation ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was infused at a rate of 2 nL/s using a microinjector (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2021Quote: ... using a vertical micropipette puller (PE-2, Narishige) via an automated injector (Nanoject III, Drummond Scientific). Tracers were injected unilaterally ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Neuroscience 2022Quote: ... −4.4 DV) at 100nl/min using a glass pipette attached to a microinjector (Nanoject 2, Drummond Scientific). Following viral infusion ...
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV viruses containing double floxed ChR2 construct (5 nl) were microinjected to the septal tissue with a micro injector (Drummond Scientific) on the second day of culturing ...