Labshake search
Citations for Drummond Scientific :
1 - 50 of 129 citations for 6 Bromo 3 4 dihydro 4 phenyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Microbiology 2024Quote: ... One-microliter capillary tubes (P1424, Microcaps; Drummond Scientific) were heat-sealed at one end and filled with either the chemotaxis buffer (negative control ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Neuroscience 2023Quote: ... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
bioRxiv - Neuroscience 2023Quote: ... A Nanoinject III (Drummond Scientific, 3-000-207) was used to deliver either 250-300 nL of the retrograde tracer Fast DiI oil (2.5 mg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Neuroscience 2021Quote: ... and mounted in a NanoJect 3 (Drummond Scientific, USA). The pipette was front loaded with the virus solution and 150 nL injected at a depth of 350-500 μm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... using a Nanoject 3 system (Drummond Scientific Company, PA) (500 nl ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2020Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Neuroscience 2022Quote: ... and glass capillaries (3-000-203-G/X, Drummond Scientific) backfilled with mineral oil ...
-
bioRxiv - Neuroscience 2023Quote: ... A glass pipette (3-000-203-G/X, Drummond Scientific) was pulled to a fine tip (P-97 Flaming/Brown Micropipette Puller ...
-
bioRxiv - Cancer Biology 2024Quote: Nanoject III Injector (Drummond Scientific Company; CA#3-000-207)
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Molecular Biology 2021Quote: ... by a Nanoject 2 (Drummond Scientific). Five ...
-
bioRxiv - Neuroscience 2023Quote: ... Viral vectors were delivered using Nanoject 3 (Drummond Scientific, Broomall, PA). The needle was held in place for >5 min after infusion at each DV ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2020Quote: ... The glass pipette (#3-000-203-G/X; Drummond Scientific, Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... The glass pipette (Drummond Scientific #3-000-203-G/X; Broomall, PA) with a beveled tip (diameter = 45 μm ...
-
bioRxiv - Immunology 2022Quote: Borosilicate glass 3.5” capillaries (Drummond Scientific Co. 3-000-203-G/X) were pulled to form thin needles in a needle puller (Narishige PC-10) ...
-
bioRxiv - Neuroscience 2022Quote: ... was injected with Nanoject-III (Drummond Scientific Company, model #3-000-207) at a depth of 200 μm beneath pia surface and virus was slowly injected at 4-5 sites ~1 to 4 mm lateral to midline of skull ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Neuroscience 2022Quote: ... 2 μL viral solution was injected in 36 steps of 55.2 nL with a one-minute interval and at a speed of 23 nL/s using a Nanoject II microinjector (Drummond Scientific, USA). After removal of the glass capillary micropipette ...
-
bioRxiv - Physiology 2022Quote: ... were co-microinjected into one- or two-cell-stage embryos (4.6 nL/embryo) using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA). The embryos were sampled after 24 h for high-resolution melt analysis (HRMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... were co-microinjected (4.6 nL) into zebrafish embryos at one- or two-cell-stage using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA).
-
bioRxiv - Neuroscience 2023Quote: ... Glass capillary used for injections (catalog # 3-000-203-G/X, Drummond Scientific) were pulled with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... a glass pipette (3-000-203-G/X, Drummond Scientific Company, PA, USA) was pulled ...
-
bioRxiv - Neuroscience 2022Quote: ... A glass pipette containing the 6-OHDA solution or vehicle secured to a Nanoject (Drummond Scientific, Broomall, PA) was then lowered through the burr holes to a depth of 5.8 mm below the brain surface ...
-
bioRxiv - Neuroscience 2020Quote: ... and adeno-associated virus (AAV) particles were injected with a Nanoject 3 (Drummond scientific) at a speed of 1 nl/sec for 30 secs injection with 30 secs pause for a total 33 cycles (i.e. ...
-
bioRxiv - Neuroscience 2019Quote: ... using a pressure injection system (Nanoject II, Drummond Scientific Company, Catalog# 3-000-204). To mark the injection site ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass capillary tube (model #3-000-203-G, Drummond Scientific Company, Broomall PA) was backfilled with mineral oil before being loaded into a Nanoject III injector (model #3-000-207 ...
-
bioRxiv - Genetics 2019Quote: ... Cold-anesthetized 5-6 day-old females were injected into their thorax using a nanoinjector (Nanoject II, Drummond Scientific) with 69 nL of bacteria or 138 nL of fluorescent beads ...
-
bioRxiv - Neuroscience 2023Quote: ... A pulled glass pipette (2-000-001, Drummond Scientific) filled with AAV vector was slowly lowered into the brain with the help of a micropositioner (Model 2650 ...