Labshake search
Citations for Drummond Scientific :
101 - 123 of 123 citations for 7 CHLORO 3 PHENYL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.5 mm relative to bregma) at 1 nl/s with a Nanoject III microinjector (Drummond Scientific, PA). Custom-made optic fibers (0.22NA ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass needles were made from 1-mm outer diameter glass pipettes (Wiretrol II, Drummond Scientific Company, Broomall, PA) pulled to a fine tip (20 - 50 µm tip diameter ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was injected with a bevelled micropipette using a Nanoject II injector (Drummond Scientific Company, Broomall, PA 1) attached to a stereotaxic micromanipulator ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
bioRxiv - Genetics 2019Quote: ... was injected into the thorax of cold-anesthetized 1 d-old female mosquitoes using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific). Mosquitoes were injected with dsRNA specific for the target gene ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 nL of the 2% DiI solution was then slowly injected into either rostral forelimb motor area (RFA) or caudal forelimb motor area (CFA) at 1 nl/sec (Nanoject III, Drummond Scientific). The coordinates for the RFA and CFA in male Long Evans rats were based on previous reports (Brown and Teskey 2014 ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus was delivered at a speed of 46 nl s−1 into the thorax using a pulled glass capillary needle and a manual microinjector (Nanoject II; Drummond Scientific). This controlled the infection dose by removing the variation that would have resulted from oral feeding ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... then injected into target brain coordinates at the rate of 1 nL per second using a Nanoject III programmable injector (Drummond Scientific). Target brain coordinates (relative to bregma ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Three doses of 32.2 nl (at 1 mg/mL) were delivered each day using a Nanoject II (Drummond Scientific Broomall, PA, USA). The head and tail of the animal was amputated on the fourth day ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Physiology 2021Quote: ... Oocytes were injected with 18.4 ng of ayRhp1 cRNA (36.8 nL with 0.5 ng nl−1) (ayRhp1) or equivalent volume of nuclease-free water (control) using a Nanoject II or III auto-nanoliter injector (Drummond Scientific, Broomall, PA, USA). Experiments were conducted three days post-injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Microinjections were performed with a 1 µL Neuros Hamilton syringe (Hamilton, Reno, NV, USA) and a micro-infusion pump (Nanoject III, Drummond Scientific; Broomall, PA, USA) that infused virus at 100 nL/min ...
-
bioRxiv - Neuroscience 2023Quote: ... at the titer of 1×1012 vg/ml in a total of 150 nl in the aid of nanoliter injector (Nanoject III, Drummond scientific, USA, Catalog #68018).