Labshake search
Citations for Drummond Scientific :
601 - 648 of 648 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...
-
bioRxiv - Microbiology 2020Quote: ... and 1.6 x 105 genome copies of SHTV with a nanoinjector (Nanoject III, Drummond Scientific). Following the injection ...
-
bioRxiv - Neuroscience 2020Quote: ... affixed to a Nanoject III (Drummond Scientific Company, Broomall, PA) pump was used to deliver 0.5 μl of virus bilaterally into the VTA (AP ...
-
bioRxiv - Neuroscience 2020Quote: ... A glass micropipette (Drummond Scientific Company, Broomall, PA), affixed to a Nanoject III (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2020Quote: ... and a glass pipette (Wiretrol II #5-000-2005, Drummond Scientific Company, Broomall, PA, USA), pulled to have an outer diameter of 60-90μm at the tip ...
-
bioRxiv - Neuroscience 2020Quote: ... and -4.5 mm DV) using a 29 G stainless steel cannula connected to a 2 μl Hamilton syringe or a Nanoject system (Drummond Scientific, PA). The injectors were retracted slowly after 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... A total of 400 nl of virus was injected in each hemisphere at 23 nl/s using the Nanoject II (Drummond Scientific Company) allowing 3 minutes for the virus to disperse throughout the tissue following each injection ...
-
bioRxiv - Neuroscience 2020Quote: ... a pulled glass micropipette was slowly lowered into the brain and left in place for 30 seconds before the virus was dispensed from the micropipette using a Nanoject injector (Drummond Scientific) at a rate of 46 nl/min (0.3 μl for PCx and 0.2 μl for AON per injection site) ...
-
bioRxiv - Neuroscience 2020Quote: ... University of North Carolina Vector Core) were delivered using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific, Broomall, PA). Following a further 5 min resting post-injection ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected in the proximity of the site of injury by electrical micro-injector (BJ110, BEX CO., LTD.) through glass capillaries (3-000-203-G/X, Drummond Scientific Company). Following injection ...
-
bioRxiv - Neuroscience 2020Quote: ... DV 2.6mm from pia) using an automated microprocessor controlled microinjection pipette with micropipettes pulled from borosilicate capillaries (Nanoject II, Drummond Scientific). Injections were performed at 0.2 Hz with 2.3 nL injection volumes per pulse ...
-
bioRxiv - Neuroscience 2020Quote: ... and pulled capillary microdispensers (Drummond Scientific). Injection volume was 250-500nl (at a 100 nl/min rate ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Developmental Biology 2020Quote: ... the tissue was gently aspirated up and down using a micropipette (made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oocytes were injected with 50.6 nl cRNA using a Drummond NANOJECT II (Drummond scientific company, Broomall Pennsylvania). For the transporter library screening ...
-
bioRxiv - Neuroscience 2020Quote: ... Glass capillaries (Wire Trol II, Drummond Scientific) were pulled on a horizontal puller (P-97 ...
-
bioRxiv - Physiology 2020Quote: ... and a total of 500 nl dsRNA solution was injected into age-matched adults using a Nanoject II injector (Drummond Scientific, PA, USA). Animals were allowed to recover for 3 days post-injection before used for experimentation.
-
bioRxiv - Developmental Biology 2020Quote: ... loaded into a fine glass needle and implanted into the abdomen of female host w1118 flies using a nanoinjector (Nanoject II Auto-Nanoliter Injector, Drummond Scientific Company, 3-000-205A). Host flies carrying allografts were kept at 25°C and examined daily for the presence of GFP in their abdomen and other tissues ...
-
bioRxiv - Developmental Biology 2020Quote: ... was injected in 50.6 nL increments (Nanoject II, Drummond Scientific) with 1-2 min between injections at 2-3 different locations in the left hindpaw for P14-P15 animal and at a single location through the skin in P4-5 pups ...
-
bioRxiv - Developmental Biology 2020Quote: ... An approximate total of 500-750 nL of Cholera toxin subunit B (CTB) AlexaFluor 488 or 647 Conjugate (Invitrogen) (Nanoject II, Drummond Scientific) was injected into 2-3 different locations in the left forepaw (Intrinsic Hand (IH ...
-
bioRxiv - Neuroscience 2020Quote: RetroBeads were injected with a NanoJect III nanoliter injector (Drummond Scientific Company) connected to a MP-285 micromanipulator (Sutter Instruments) ...
-
bioRxiv - Neuroscience 2020Quote: ... Equivalent dose of lentivirus 1.0 μL of pLenti-CaMKII-TRPV1-p2A-mCherry-WPRE solution or 0.64 μL pLenti-CaMKII-mCherry-WPRE) was injected into the somatosensory cortex of Thy1-GCaMP6f mice using a microinjector (Nanoject II; Drummond Scientific) at a speed of 0.69 μL /min ...
-
bioRxiv - Neuroscience 2020Quote: ... Five pressure microinjections of 23 nl of Fluorogold (Fluorchrome) were performed on each side of the dorsal funiculus (Drummond Scientific, Nanoject II). Five days after injection ...
-
bioRxiv - Neuroscience 2020Quote: ... and virus was injected using either a Nanoject (Drummond Scientific) and glass pulled pipette or a syringe pump (Harvard Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.53 mm inner diameter capillary glass (cat# 3-000-203-G/X, Drummond Scientific Company) with a P-1000 microelectrode puller (Sutter Instrument) ...
-
bioRxiv - Neuroscience 2020Quote: ... glass pipettes (Drummond Scientific Company) were pulled and sharpened to have a bevel of 35° and an opening of 20 μm at the tip ...
-
bioRxiv - Neuroscience 2020Quote: ... All viral injections were performed using a Nanoject III (Drummond Scientific Company) at 1 nL/min ...
-
bioRxiv - Immunology 2020Quote: ... were intrathoracically injected with 69 nl of PGE2 (500 nM) or 0.05% ethanol PBS using a Nanoject III (Drummond Scientific). Kanamycin resistant E.coli constructed by transformation with mCherry2-N1 plasmid was cultured in Luria Bertani (LB ...
-
bioRxiv - Immunology 2020Quote: ... were anesthetized on ice and intrathoracically injected with 69 nl (∼200 ng) of dsRNA per mosquito using Nanoject III injector (Drummond Scientific Company). The dsRNA treated mosquitoes were kept at 19°C for 4 days ...
-
bioRxiv - Plant Biology 2020Quote: ... 46 nL/23 ng of cRNA or equal volumes of RNase-free water were injected into oocytes with a Nanoinject II microinjector (Drummond Scientific). Oocytes were incubated for 48 h in Calcium Ringer’s solution (96 mM NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were injected through pulled borosilicate glass micropipettes (Drummond Scientific; PA, USA) with tip diameters ~40 μm ...
-
bioRxiv - Neuroscience 2020Quote: ... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Neuroscience 2020Quote: ... 200 nl of undiluted viral vector were injected into each hemisphere using glass pipettes attached to either a Nanoject III (Drummond Scientific), with a constant flow rate of 1 nl per second ...
-
bioRxiv - Neuroscience 2020Quote: ... +0.2 and ML: 2.5 and DV: -4.6 & -4.4 relative to bregma using a Nanoject III microinjector (Drummond Scientific, Broomall, PA). 100 µm-core optic fibers (Precision Fiber Products ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2020Quote: ... was injected using a glass pipette with a Nanoject II (Drummond Scientific) delivery system at a rate of 0.4 nL/s ...
-
bioRxiv - Cell Biology 2020Quote: ... before being loaded with virus or toxin (Nanoject II, Drummond Scientific) and positioned at the stereotaxic coordinates indicated below ...
-
bioRxiv - Cell Biology 2020Quote: ... Glass pipettes (Drummond Scientific) were formed using a P-2000 puller (Sutter Instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were injected using a Nanoject III (Drummond Scientific) with a pulled glass micropipette ...
-
bioRxiv - Bioengineering 2020Quote: ... was made and a total of 2 µl of MENPs or MSNPs were injected with a microinjection apparatus Nanoject II (Drummond Scientific). In phase-I in vivo experiment MENPs injection was conducted only in right hemisphere to compare microglia and astrocytes population between injected and intact hemispheres ...
-
bioRxiv - Microbiology 2020Quote: ... or (b) 50 nl of freshly grown SINV (1010 PFU/mL) using a nanoinjector (Drummond Scientific). Pools of five flies (representing a single biological replicate ...
-
bioRxiv - Neuroscience 2020Quote: ... The glass needles were mounted on a Nano-injection system (Nanoject II, Drummond Scientific Company, Broomall, PA, United States), which could precisely control the amount of injected solution at the nanoliter level ...
-
bioRxiv - Neuroscience 2020Quote: ... Using a stereotax and the Nanoject II (Drummond Scientific, Broomall, Pennsylvania), a pulled-glass pipette (BF150-117-10 ...
-
bioRxiv - Neuroscience 2020Quote: ... The virus was injected via a glass micropipette (Drummond Scientific Company, Broomall, PA) into the VTA at the rate of 100 nl/min for a total volume of 500 nL ...
-
bioRxiv - Genetics 2020Quote: ... flies were anesthetized with CO2 and injected with 23 nL of bacteria or PBS using a pulled glass capillary and an automatic nanoliter injector (Drummond Scientific, Broomall, PA). Individual flies were injected at the ventrolateral surface of the fly thorax and placed into new vials ...
-
bioRxiv - Neuroscience 2020Quote: ... The injection system comprised of a pulled glass pipette (25–30 um O.D.; Drummond Scientific, Wiretrol II Capillary Microdispenser) back-filled with mineral oil ...