Labshake search
Citations for ChromoTek :
51 - 100 of 130 citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... α-Myc(rat)-1:1,000 (ChromoTek, Planegg-Martinsried, Germany), α- HA(rat)-1:2000 (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... α-RFP(rat)-1:1,000 (ChromoTek, Planegg-Martinsried, Germany), α-Myc(rat)-1:1,000 (ChromoTek ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-RFP (1:1000, rat monoclonal, 5F8 ChromoTek or 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-RFP (ratRFP; Chromotek; 1:1000) were used to enhance the signal of GFP and RFP ...
-
bioRxiv - Plant Biology 2024Quote: ... and monoclonal anti-HA produced in rat (Chromotek). As for secondary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... rat monoclonal to myc-tag (Chromotek #9e1, 1:500), mouse monoclonal to Alpha Adaptin (Thermo #MA1-064 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rat monoclonal antibody: HA (Chromotek, 7c9, WB: 1:1000). Rabbit polyclonal antibodies ...
-
bioRxiv - Plant Biology 2022Quote: ... a monoclonal RFP antibody raised in Rat (Chromotek, 5F8), followed by IRDye® 800CW goat anti-Rat IgG secondary antibody (Licor ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary Rat anti-RFP (mAb 5F8 Chromotek, 1:500) and secondary goat anti-rat Cy3 (Jackson 112-165-167 ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-RFP (Chromotek 5F8; RRID:AB_2336064; WB: 1:1000); chicken anti-MAP2 (Antibodies-Online ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-RFP at 1:200 (5F8-10, Chromotek), rabbit Myl7 1:200 at (GTX128346 ...
-
bioRxiv - Plant Biology 2021Quote: ... a rat anti-RFP monoclonal antibody (1:10,000; Chromotek), and a mouse anti-GFP monoclonal antibody (1:5,000 ...
-
bioRxiv - Plant Biology 2019Quote: ... and rat monoclonal anti-RFP antibody (1:5,000; Chromotek), respectively.
-
bioRxiv - Plant Biology 2020Quote: ... or c-Myc rat monoclonal antibody (Chromotek, 9E1-100) at a dilution of 1:1000 followed by goat anti-rat IgG horseradish peroxidase (Abcam ...
-
Cellular identity and Ca2+ signaling activity of the non-reproductive GnRH system in the Ciona larvabioRxiv - Neuroscience 2020Quote: ... rat anti-red fluorescent protein (RFP) monoclonal (5F8; ChromoTek GmbH ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-RFP (1:500, rat monoclonal, Chromotek, 5f8-100), anti-Doublecortin (1:1000 ...
-
bioRxiv - Immunology 2019Quote: ... TdTomato (rat monoclonal, Chromotek, 5F8, used at 1:500); TdTomato (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-RFP (1:1000, Chromotek, 5f8-100, RRID:AB_2336064); chicken anti-S100B (1:500 ...
-
bioRxiv - Plant Biology 2020Quote: ... A rat monoclonal anti-RFP antibody (Chromotek, cat. no. 5F8) was used at 1:1000 dilution and combined with a 1:5000 donkey anti-rat secondary antibody (Agrisera ...
-
bioRxiv - Neuroscience 2022Quote: ... rat monoclonal anti-red fluorescent protein (RFP) (Chromotek, 1:1000) and goat anti-mCherry (1:1000) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat anti-RFP (1/500, v/v; Cat#5f8, Chromotek), Mouse anti-GFP (1/600 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-myc (Chromotek, 9e1-100, 1/500 for ICC), chicken anti-GFP (AvesLab ...
-
bioRxiv - Plant Biology 2022Quote: ... and then incubated with anti-GFP antibodies (Rat monoclonal, ChromoTek) diluted 1/1500 in TBS containing 0.1% Tween overnight at 4C ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-RFP (Chromotek 5F8ChromoTek 5f8-100, WB: 1:1000); chicken anti-MAP2 (antibodies Antibodies-Online ABIN361345 ...
-
bioRxiv - Neuroscience 2022Quote: ... red fluorescent protein (RFP; rat, Chromotek: 5F8, RRID: AB_2336064; 1:2000) FoxP2 (mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-MYC (1:1000; Chromotek, Germany, Cat. No. 9e1-20) and rabbit anti-REGE-1 polyclonal antibody raised against the first 119 amino acids (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-RFP (1:1000, Chromotek, Cat# 5f8-100, RRID: AB_2336064), rabbit anti-tomosyn (1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using rat anti-mCherry (1:5,000; ChromoTek), chicken anti-GFP (1:5,000 ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-HA and anti-FLAG antibodies produced in rat (Chromotek, UK) were used as primary antibodies ...
-
bioRxiv - Plant Biology 2022Quote: ... rat anti-red fluorescent protein (RFP) (5F8, Chromotek, Planegg-Martinsried, Germany) (1:10,000) ...
-
bioRxiv - Neuroscience 2019Quote: ... or TdTomato (1:1000; rat; anti-RFP; Chromotek, CAT#:5f8-100, RRID:AB_2336064) and Goat-Anti-chicken AlexaFluor488 (1:500 ...
-
bioRxiv - Neuroscience 2019Quote: ... or TdTomato (1:1000; rat; anti-RFP; Chromotek, CAT# 5f8-100, RRID:AB_2336064) or slices were co-stained with the nuclear marker 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... RFP detection was performed with a rat anti-RFP 5F8 antibody (Chromotek) and an HRP-conjugated anti-rat antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... The mCherry fluorescent signal was enhanced with rat mAb anti-RFP (Chromotek). As secondary antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... Nitrocellulose membranes were probed with rat anti-GFP (3H9, Chromotek, 1:2,500), PAP (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Antibodies used were as follows: rat anti-RFP (Chromotek, 5F8; 1:200), rabbit anti-RFP (MBL ...
-
bioRxiv - Cell Biology 2019Quote: The following antibodies were used for immunofluorescence: rat anti-RFP (Chromotek 1:1000); mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Pathology 2020Quote: ... The blot was further probed with anti-Myc rat monoclonal antibody (Chromotek, 9E1) in a 1:1,000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Plant Biology 2021Quote: ... The membranes were incubated with primary rat monoclonal anti-5F8 antibody (Chromotek, 1:1000) and secondary bovine anti-rat horseradish peroxidase (HRP)-conjugated (1:5000 ...
-
bioRxiv - Plant Biology 2019Quote: ... RFP-fused proteins were detected using a rat anti-RFP antibody (1:5,000; ChromoTek). Light harvesting complex protein (LhcB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primary antibodies were used: Rat monoclonal anti-GFP antibody (Chromotek, 80626001AB, 1:5,000), Mouse monoclonal anti-tubulin anti-body (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... mCherry proteins were detected by a rat anti-RFP antibody (5F8-100, 1:2,000, Chromotek), and then with a goat anti-rat IgG HRP-conjugated secondary antibody (AP202P ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunocytochemistry was performed with the following primary antibodies: rat anti-GFP (Chromotek, 50430-2-AP) 1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rat antibodies for the detection of phosphorylated RNAPII (serine 5 and serine 2) (Chromotek, 1: 100) and secondary goat anti-rat Alexa Fluor 488 antibodies (A-11006 ...
-
bioRxiv - Plant Biology 2022Quote: ... Successful affinity purification was confirmed by western blotting using Rat monoclonal anti-GFP antibody (3H9, Chromotek) and AffiniPure Donkey Anti-Rat IgG-HRP (712-035-153 ...
-
bioRxiv - Plant Biology 2023Quote: ... GFP tagged proteins were detected using an anti-GFP antibody (1:4000; mAb rat 3H9; Chromotek) and a secondary anti-rat antibody (1:15000 ...
-
bioRxiv - Plant Biology 2019Quote: ... For RNA Pol II phosphorylated at serine 2 in CTD domain rat 3E10 antibody was used (Chromotek), diluted 1:100 ...
-
bioRxiv - Plant Biology 2019Quote: ... For RNA Pol II phosphorylated at serine 5 in CTD domain rat 3E8 antibody was used (Chromotek), diluted 1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... The signal of mCherry and GFP was enhanced using a rat mAb anti-RFP (Chromotek, 5f8-100) and a rabbit pAb anti-GFP antibody (BIOZOL/MBL ...