Labshake search
Citations for ChromoTek :
1 - 50 of 351 citations for F actin uncapping protein LRRC16A CARMIL1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells with Tks5αGFP were cultured on HDFC prepared on #1.5 coverglass for 2 days before stained for F-actin (phalloidin-Alexa Fluor-647) and Tks5αGFP (GFP-nanobody, ChromoTek GFP Vhh, # gt-250) using manufacturer recommended procedures ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent nuclear actin nanobody (nuclear actin chromobody) plasmid was purchased from ChromoTek and transferred into the HindIII-EcoRI site of pGEMHE ...
-
bioRxiv - Synthetic Biology 2021Quote: ... FITC MEF values were converted to equivalent fluorescent protein concentrations using calibration curves made using recombinant eGFP from ChromoTek GmbH (reference EGFP-250 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclear actin filaments were visualized with a GFP tagged nuclear actin chromobody (Chromotek) and filaments were induced with 8 µM Ionphore A23187 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were detected using anti-GFP antibody (3H9, Chromotek) or anti-alpha tubulin (T5168 ...
-
bioRxiv - Cell Biology 2022Quote: ... Actin-Chromobody-TagGFP2 (AC-GFP, Chromotek), LifeAct-TagGFP2 (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... or the 32F6 IgG2c monoclonal antibody against mNeonGreen protein (Chromotek). After several 5 min washes in PBS ...
-
bioRxiv - Plant Biology 2024Quote: ... GFP-tagged proteins were detected by α-GFP antibodies (ChromoTek).
-
bioRxiv - Biophysics 2023Quote: ... The Actin-chromobody (ChromoTek Inc., Hauppauge, NY) containing a C-terminal EmeraldFP–6xHIS tag was cloned into pET22b (Novagen ...
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Cell Biology 2024Quote: ... For detection of mCherry-tagged proteins monoclonal igG2c RFP antibody (Chromotek) (1:2000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... and actin chromobody GFP (pAC-TagGFP from Chromotek) were obtained by transfection with Fugene HD according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Actin was marked using the mammalian expression vector encoding the cytoskeleton marker Actin-VHH fused to either or RFP or GFP2 and commercially sold as Actin-Chromobody® (Chromotek)
-
bioRxiv - Plant Biology 2021Quote: ... the protein–chromatin solution was incubated with GFP antibody-conjugated magnetic beads (ChromoTek) under 4°C overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... total proteins were incubated with 10 μl agarose conjugated anti-GFP antibodies (Chromotek) for 3 h and washed 3 times with the washing buffer (50 mM HEPES [pH 7.5] ...
-
bioRxiv - Cell Biology 2021Quote: ... the proteins were detected by Western blot analyses with the indicated antibodies (GFP (Chromotek) 1:4,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Detection of Venus-tagged proteins was based on anti-GFP tag Polyclonal IgG antibody (Chromotek) (1:1000 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: The AC-TagGFP2 sequence from the Actin-Chromobody plasmid (TagGFP2) (Chromotek) was cloned into the pMTB vector for mRNA generation ...
-
bioRxiv - Plant Biology 2023Quote: ... GFP tagged proteins were detected using an anti-GFP antibody (1:4000; mAb rat 3H9; Chromotek) and a secondary anti-rat antibody (1:15000 ...
-
bioRxiv - Cell Biology 2022Quote: ... except GFP booster-FITC was used for YFP detection (Chromotek, gb2AF488-10, 1:500). Z-stacks with 200 nm intervals were taken with Thunder Imaging System (Leica ...
-
bioRxiv - Microbiology 2020Quote: ... antibody and protein G beads and GFP-ARTD12 with 5 µl of GFP-Trap magnetic agarose beads (Chromotek) at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... falciparum D10) or GFP-TRAP (PfSkp1GFP-epi, PfCul1GFPKI, and GFP control) antibodies (15 µl slurry/2 mg protein; ChromoTek) for 2 hours at 4°C with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... A 30% suspension of protein A sepharose beads in RIPA buffer were incubated with the mNG antibody (32F6 Chromotek) for 1 hr at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... the nAC-TagGFP2 fragment was amplified from vector Actin-Chromobody® Plasmid (TagGFP2) (ChromoTek, Germany) and cloned into HindIII/BamHI digested pDEXCuo-GFP/bla vector ...
-
bioRxiv - Cell Biology 2024Quote: ... The insoluble material was removed by centrifugation and the lysates were subjected to immunoprecipitation either by subsequent incubations with anti-Ecad antibody SHE78-7 (4 μg/ml) and protein A-beads or by incubation with GFP-trap beads (Chromotek). After incubation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... FITC MEF and micromolar concentration values were obtained by calibration curves made using recombinant eGFP from ChromoTek GmbH (reference EGFP-250).
-
bioRxiv - Neuroscience 2020Quote: ... approximately 500 µg of cellular protein was incubated with 1 ug of flag antibody or 20 µL of RFP-Trap®_MA (Chromotek). The magnetic beads were collected using a magnet and washed three times in NP-40 lysis buffer ...
-
bioRxiv - Plant Biology 2020Quote: Blotted proteins were detected using anti-GFP (LifeTechnologies, Darmstadt, Germany) and anti-red FP (RFP) antibody (ChromoTek GmbH, Planegg-Martinsried, Germany) (both ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP tagged AMPKγ3 was then immunoprecipitated by incubating 400 µg of protein with 1 µg of anti-GFP antibody (Chromotek, cat no. 3H9) and 15 µl of protein G sepharose beads (Cytiva ...
-
bioRxiv - Neuroscience 2020Quote: ... or Alpaca antibody against Green Fluorescent Protein conjugated to Alexa Fluor 488 (also labels EBFP2, Figure 6B, Chromotek, cat# gb2AF488, 1:100 dilution) to enhance the EBFP2 signal in the green color channel along with DAPI (blue to stain nuclei ...
-
bioRxiv - Biochemistry 2024Quote: ... the three proteins were co-expressed in FreeStyle293-F cells and GFP-trap was performed as described in the previous section using GFP-Trap magnetic agarose (Chromotek). The immunoprecipitated complex was then added to reaction buffer (20mM Tris ...
-
bioRxiv - Plant Biology 2020Quote: ... and the protein extract was separated on reducing SDS-PAGE and probed with commercial anti-RFP or anti-GFP antibodies (6G6, Chromotek or ab290, Abcam, respectively) to detect mCherry tagged MSBP1 or GFP-tagged ATI1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of extract protein were incubated with GFP-binding protein-conjugated agarose (Chromotek) or anti-RFP antibody (Anti-RFP RTU - Rockland Biosciences ...
-
bioRxiv - Microbiology 2022Quote: GFP-tagged target proteins and interacting proteins were affinity purified using GFP-trap agarose beads (Chromotek). Proteins were processed ...
-
bioRxiv - Cell Biology 2020Quote: ... recombinant binding protein (gt-250, Chromotek). The secondary antibodies we used were AffiniPure goat anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primary antibodies used: GFP Monoclonal antibody (3H9, Chromotek) 1:1000-2000 ...
-
bioRxiv - Plant Biology 2022Quote: ... α-RFP antibody (1:5000) (ChromoTek, α-RFP antibody [6G6]), α-AP2S antibody79 (1:500) ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were determined and an equal amount of protein was mixed with TurboGFP-Trap Magnetic Agarose (Chromotek) for 1 hour at RT with agitation ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were detected using α-HA (Chromotek) and α-GFP antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2024Quote: ... Proteins immunoprecipitated with Myc-trap beads (ChromoTek) at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP fusion proteins were purified as follows: 200mg of protein extract was incubated with GFP-Trap Magnetic Agarose (ChromoTek) at 4°C for 20 minutes with gentle agitation ...
-
bioRxiv - Plant Biology 2023Quote: GFP-tagged or RFP-tagged proteins were immunoprecipitated from total leaf protein extract by incubation with GFP-Trap or RFP-Trap magnetic agarose beads (ChromoTek). The Co-immunoprecipitation assay was carried out according to ChromoTek’s instructions whereby 300 μl of protein extract was diluted with 500 μl of ice-cold dilution buffer [10 mM Tris-HCl (pH 7.5),150 mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... and proteins were purified by GFP-trap (ChromoTek) immunoprecipitation for 1 hour at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein complexes were immunoprecipitated using GFP-Trap (Chromotek) and washed 3 times with 50mM ammonium bicarbonate after the precipitation to remove detergent ...
-
bioRxiv - Systems Biology 2023Quote: ... The proteins were immunoprecipitated using GFP-Trap (Chromotek) according to manufacturer’s protocol (with slight modifications) ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were incubated with GFP-Trap (ChromoTek) beads for 1h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: Antibodies against GFP (Chromotek), anti-PsbA/D1 (Agrisera) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Anti-GFP antibody (Chromotek) (25 µL ...
-
bioRxiv - Biophysics 2020Quote: ... they were incubated with unlabelled (GFP-binding protein, Chromotek) and Abberior 635P conjugated Nanobody (GFP-booster ...
-
bioRxiv - Cell Biology 2021Quote: ... protein lysates were added to RFP-Trap beads (Chromotek) and incubated for one hour at 4°C on a rotating shaker ...