Labshake search
Citations for Invivogen :
1 - 50 of 376 citations for pVectOZ CAT Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Control antibodies for RBD (InvivoGen, Cat No. srbd-mab12) and N (AcroBiosystems ...
-
bioRxiv - Immunology 2023Quote: ... positive control antibodies for RBD (InvivoGen, Cat No. srbd-mab6) and N (GenScript ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µg/ml Tri-Lys (negative control for NOD1/NULL1) or 10 µg/ml MDP-control (MDP-c; negative control for NOD2/NULL2) (InvivoGen) were used as treatment controls ...
-
bioRxiv - Immunology 2023Quote: ... using transfection reagent LyoVec (InvivoGen) for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: For transfections of gp130 WT (InVivoGen) and gp130 mutant plasmids (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... and isotype control (bgal-mab12, InvivoGen) were added at the time of stimulation ...
-
bioRxiv - Cancer Biology 2021Quote: ... or control agonist (Invivogen #tlrl-3prnac) were transfected with LyoVec™ (Invivogen #lyec-12 ...
-
bioRxiv - Bioengineering 2023Quote: ... ds-ppp-RNA positive control (InvivoGen), ss-ppp-miRNA-21 (8 µg/mL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or control agonist (Invivogen #tlrl-3prnac) were transfected with a cationic lipid-based transfection reagent -LyoVecTM (Invivogen #lyec-12 ...
-
bioRxiv - Immunology 2024Quote: ... Matched negative controls ODN 5328 (InvivoGen) or CL075 (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of interferon-stimulatory DNA (ISD) (InvivoGen) into the cytosol of BMDMs was performed using Polyethyleneimine (PEI ...
-
bioRxiv - Microbiology 2020Quote: ... or corresponding isotype controls (10μg/ml, Invivogen), or different concentrations of R406 (Invivogen) ...
-
bioRxiv - Systems Biology 2023Quote: ... and as a negative control Ovalbumin (InvivoGen) were coupled to uniquely coded beads (xMAP MagPlex Microspheres ...
-
bioRxiv - Immunology 2020Quote: ... Immune cell stimulations were performed in the absence (Control) or presence of 0,1 μg/ml of extrapure Lipopolysacharide (Invivogen LPS, Cat. tlrl-3pelps), 10 μg/ml Poly I:C (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... mice were intradermally injected with 50 μg of neoantigen or control peptide and/or 100 μg high molecular weight VacciGrade polyinosinic-polycytidylic acid (poly(I:C) (Invivogen Cat. No. vac-pic)) ...
-
bioRxiv - Immunology 2021Quote: ... Transfection of DNA and Poly(I-C) (InvivoGen) was performed with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... normal rat PAb IgG control blocking antibodies (InvivoGen), Dexamethasone (10µM ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection of HSV-60bp interferon-stimulatory DNA (ISD) (InvivoGen) into the cytosol of BMDMs was performed using Polyethyleneimine (PEI ...
-
bioRxiv - Bioengineering 2023Quote: ... using LyoVec transfection agent (Catalog Code: lyec-12, InvivoGen). After a 48-h incubation ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µg/ml TriDAP (positive control for NOD1/NULL1) (InvivoGen) or 10 µg/ml muramyl dipeptide (MDP ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of three to five control shRNAs (Invivogen) and a blasticidin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... or 200 µg of isotype control antibody (mouse IgG2a, Invivogen) three times at days 6 ...
-
bioRxiv - Bioengineering 2023Quote: ... The ds-ppp-RNA positive control (1 µg/mL, (InvivoGen), ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Then ds-ppp-RNA positive control (1 µg/mL, InvivoGen) or ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Immunology 2019Quote: ... 72h after transfection cells were treated with puromycin (Invivogen, 1μg/ml) for 1 week ...
-
bioRxiv - Biochemistry 2021Quote: ... Transfection with poly(I:C) (Invivogen #tlrl-pic; 1 μg/ml final) was performed using Lipofectamine 3000 as described above ...
-
bioRxiv - Immunology 2022Quote: ... THP-1 Dual Control and cGAS−/− cells were obtained from Invivogen. THP-1 IFIT1 cells were maintained in RPMI (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... anti-TLR2-IgA and IgA control antibody were purchased from Invivogen. Anti-TLR5-Fc mouse was purchased from R&D Systems ...
-
bioRxiv - Microbiology 2019Quote: ... THP-1 Dual Control and cGAS-/- cells were obtained from Invivogen. Lopinavir (LPV) ...
-
bioRxiv - Microbiology 2023Quote: ... THP-1 Dual Control and cGAS-/- cells were obtained from Invivogen. Nevirapine and raltegravir were obtained from AIDS reagents ...
-
bioRxiv - Molecular Biology 2020Quote: ... Poly(I:C) was provided pre-complexed with transfection reagent (Invivogen tlrl-piclv), and was reconstituted fresh with molecular grade water before added to cells at a concentration of 500 ng/mL.
-
bioRxiv - Immunology 2019Quote: Transfection of cells with Fagellin (Invivogen, 0, 5µg/mL/2,5×105 cells) or LPS (O111:B4 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated 24 hours post plasmid transfection with poly I:C (Invivogen), concentrations stated in figures (final 250μl volume per well) ...
-
bioRxiv - Immunology 2020Quote: ... transfection was performed with 20 ng of the STING plasmid constructs (InvivoGen; San Diego ...
-
bioRxiv - Biochemistry 2022Quote: ... Each transfection mixture was completed with NOD2 activator MDP (tlrl-mdp, InvivoGen) and cells were lysed 22h after transfection in 143 μl of Cell Lysis buffer (Cell Signaling ...
-
bioRxiv - Biochemistry 2024Quote: ... and media were supplemented with normocin (100 ug/mL) during transfection (Invivogen). For lysis ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine 3000 transfection kit was purchased from InvivoGen (San Diego, CA, USA). Phospho-IRF3(Ser396 ...
-
bioRxiv - Microbiology 2020Quote: ... Control mice received PBS or alum in the form of Alhydrogel (InVivogen) diluted in PBS (n = 20-25 mice/group) ...
-
bioRxiv - Bioengineering 2020Quote: ... The Fc control protein was derived from the pFuse-IgG1e3-Fc2 (InvivoGen). For the generation of full length PSG1-Fc and PSG9-Fc ...
-
bioRxiv - Bioengineering 2023Quote: ... and treated with ds-ppp-RNA positive control (1 µg/mL, (InvivoGen), ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transfected with a cationic lipid-based transfection reagent -LyoVecTM (Invivogen #lyec-12) following tmanufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/ml muramyl dipeptide (MDP; positive control for NOD2/NULL2) (InvivoGen), 10 µg/ml Tri-Lys (negative control for NOD1/NULL1 ...
-
bioRxiv - Immunology 2020Quote: ... 20 μL Flagellin from Salmonella typhimurium as a control (Standard FLA-ST (Invivogen) or leptospires resuspended in PBS at a MOI between 1:50 to 1:200 were added in empty wells ...
-
bioRxiv - Cancer Biology 2024Quote: ... A positive control of 2 µg/ml of Puromycin (InVivoGen, ant-pr-1) was included ...
-
bioRxiv - Cell Biology 2022Quote: ... 72 hours following transfection cells were selected in 1uM Blasticidin (Invivogen, #ant-bl-05) and 100ug/mL Hygromycin B Gold (Invivogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... according to the manufacturer’s instructions and media were supplemented with Normocin during transfection (Invivogen).
-
bioRxiv - Microbiology 2023Quote: ... cells were stimulated by transfection with 1 μg of poly(I:C) (tlrl-pic; Invivogen) for an additional 8 hours at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...