Labshake search
Citations for Invivogen :
601 - 650 of 2088 citations for Triclosan Unlabeled 100 Ug Ml In Mtbe 2 4 4 Trichloro 2 Hydroxydiphenyl Ether since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 μg of M2ex3 antigen + 40 μg CpG (oligonucleotide 1826, a TLR9 agonist from InvivoGen), or 2 μg of M2ex3 + 40 μg STING agonist (2’3’-c-di-AM(PS)2(Rp,Rp) ...
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Immunology 2021Quote: ... for 1 hour (for neutrophil cultures) and LPS (50-100 ng/ml Ultrapure, InvivoGen) or Pam3Cys (500 ng/ml ...
-
bioRxiv - Immunology 2021Quote: ... cells were pre-treated with 100 ng/mL Ultrapure LPS (Invivogen, Cat# tlrl-3pelps) in serum-free Opti-MEM medium (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and stimulated for 16-24 hours with 100 μg/mL polyI:C (tlrl-picw, Invivogen). LDH assays were performed on supernatants after stimulation as previously described (Decker ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Developmental Biology 2022Quote: ... dTomato-positive cells were sorted on a BD FACS Aria III using BD FACSDiva 8.0.1 Software using a 100 µm nozzle and cultured on Martigel-coated plates in mTeSR Plus supplemented with 100 µg/ml Primocin (InvivoGen, ant-pm-1) and 25 µm Y-27632 ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Molecular Biology 2021Quote: HEK cell lines were transfected at 70% confluency with 100 ng/mL 3p-hpRNA (Invivogen) using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Successful integration was monitored by antibiotic selection with hygromycin B (100 µg ml−1, Invivogen) and blasticidin (5 µg ml−1 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... THP1-Lucia™ were treated alternately with zeocin and normocin (100 μg/mL; Invivogen, USA). HCEC-1CT cells were cultivated in Dulbecco’s Modified Eagle’s Medium (high glucose ...
-
bioRxiv - Immunology 2020Quote: ... BMDMs were mock treated (media only) or stimulated with 100 ng/mL of LPS (InvivoGen) for 4 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... PBMCs were rested and stimulated with 100 ng/ml LPS (from E. coli K12, Invivogen) or 0.1 μM CpG 2006 (TIB MOLBIOL) ...
-
bioRxiv - Immunology 2021Quote: ... at 100 ng/mL or the TLR9 agonist class A CpG ODNs (CpG-A; Invivogen) at 5 μM or the STING agonist cGAMP (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) of penicillin/streptomycin and 100 µg/ml of Normocin/Zeocin/Blasticidin (InvivoGen). The test media for A549 and THP-1 cells excluded Zeocin and Blasticidin from their respective growth media.
-
bioRxiv - Immunology 2021Quote: ... For gene expression analysis HL-60 cells were stimulated with 100 ng/ml LPS (InvivoGen) for 6 hours.
-
bioRxiv - Microbiology 2023Quote: ... 10 µmol Y-27632 Rock inhibitor and 100 µg/ml normocin (InvivoGen, San Diego, USA) medium in a humidified 5% CO2 incubator at 37ºC ...
-
bioRxiv - Immunology 2023Quote: ... GMDCs were either left untreated or activated with 100 ng/mL of LPS (ultrapure, InvivoGen) and after 24 hours semi-adherent cells were harvested for various assays
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Neuroscience 2020Quote: ... Cells were activated with LPS (100 ng mL-1 E. coli O55:B5, triple-purified, InvivoGen) for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: Stable AtT20 cell lines expressing A1Pi constructs were selected using 100 µg/ml G418-sulfate (Invivogen). EBFP cloned into pcDNA3 (hygromycin B as selective antibiotic ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTer-β-cat cell media was supplemented with 100 µg/ml Zeocin (InvivoGen, ant-zn-05) to select for the β-catenin RNAi cassette.
-
bioRxiv - Immunology 2020Quote: ... Treatment of live leptospires was performed with 100 μg/mL of the human cathelicidin LL37 (Invivogen) in PBS for 2 hours.
-
bioRxiv - Immunology 2022Quote: ... cells were maintained in DMEM complemented with 100 μg/mL of Normocin (Invivogen, ant-nr-1), 10% heat inactivated FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... BMDM were then treated for 24 hrs with 100 ng/mL lipopolysaccharide (LPS; Invivogen #tlrl-3pelps), followed by addition of 2mM ATP along with 10 ng/mL of either anti-mouse/rat IL-1β neutralizing antibody (Invivomab #BE0246 ...
-
bioRxiv - Immunology 2023Quote: ... autophagy reporter cells (transfected with LC3-GFP-RFD) were cultured with 100 µg/mL zeocin (Invivogen). Cells were seeded in plates (TPP ...
-
bioRxiv - Neuroscience 2023Quote: ... microglia cells were first primed with 100 ng/ml ultrapure LPS (E. coli 0111:B4, Invivogen) and then incubated at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng mL-1 full-length flagellin (FFLG) (containing 0.01% sucrose; tlrl-pstfla; Invivogen, CA, USA); 50 µg mL-1 lipooligosaccharides (LOS ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK-Blue IFN-α/β were cultured with 100 μg/ml Zeocine (InvivoGen #ant-zn-1) and 30 μg/ml Blasticidine (InvivoGen #ant-bl-05) ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...