Labshake search
Citations for Invivogen :
1 - 50 of 208 citations for Mouse Protein N terminal asparagine amidohydrolase NTAN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant RBD protein containing a C-terminal 6xHis tag was formulated with the Alhydrogel adjuvant (Invivogen) and each vaccine dose contained 5 μg of RBD and 500 μg of aluminum hydroxide ...
-
bioRxiv - Immunology 2022Quote: ... IFNβ was measured with a bioluminescent ELISA kit (LumiKine, Invivogen). For experiments involving blocking antibodies (Abs) ...
-
bioRxiv - Immunology 2023Quote: ... IgG3 concentrations were measured by an IgG3 Human ELISA Kit (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... Soluble Fc-mDectin-1a containing the C-terminal extracellular domain of mouse Dectin-1a fused with the human IgG1 Fc domain was purchased from Invivogen. Overnight C ...
-
bioRxiv - Cancer Biology 2021Quote: ... supernatant was harvested and IFN levels were quantified by Lumikine mouse IFN luminescent ELISA (Invivogen, Cat# luex-mifnbv2) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: Supernatants were collected and ELISA (InvivoGen) with different cytokines were performed according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2019Quote: ... a Mouse TLR Agonist kit was purchased from Invivogen and BMDMs were treated with each ligand for 16 hours ...
-
bioRxiv - Immunology 2024Quote: ... were immunised IM with 10 µg N-half RIPR or 13 µg full-length RIPR protein formulated in AddaVax™ (Invivogen, France) on days 0 ...
-
bioRxiv - Immunology 2021Quote: ... Mouse IFN-α was measured by a bioluminescence kit (InvivoGen). All assays were performed on cell free supernatants according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and assayed by ELISA using IFNβ (Invivogen #luex-mifnbv2), IP-10 (R&D #DY466) ...
-
bioRxiv - Immunology 2024Quote: ... ODN1826 and ODN2395 were from a mouse TLR9 agonist kit (Invivogen, tlrl-kit9m). Poly(I:C ...
-
bioRxiv - Neuroscience 2023Quote: ... with cMyc tag and 6xHis-tag at the nanobody’s C-terminal were cloned into a pFUSE-derived vector (InvivoGen). The vector was used to transform Expi293F mammalian cells (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... and BA.4/5 variants harboring GFP and luciferase reporter genes was performed as previously described for the WT PSV.43 Plasmids carrying the full-length SARS-CoV-2 spike protein from each variant containing a C-terminal 19 amino acid deletion to remove the ER retention signal were used for pseudotyping (Invivogen). Viral titers (TU/mL ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatants were harvested and analyzed for IFNγ induction using via IFNγ ELISA (InvivoGen). For some experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Immunology 2022Quote: ... indicated dose of conjugated or free SOSIP proteins (25 μg mi3-conjugated SOSIP per mouse in most experiments) were mixed with 20 μg MPLA (Invivogen, vac-mpls) and 10 μg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Immunology 2022Quote: ... mouse TLR2 neutralizing antibody monoclonal mouse IgG2a (C9A12) and control isotypes mouse IgG2a were from InvivoGen. Mouse TLR4/MD2 complex neutralizing antibody monoclonal rat IgGk clone MTS510 and control isotypes rat IgGk were from eBioscience™ Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... or OVA protein (InvivoGen) was administered iv to the infected mice.
-
bioRxiv - Microbiology 2020Quote: ... or OVA protein (InvivoGen) adjuvanted with 1 μg of monophosphoryl lipid A (MPLA ...
-
bioRxiv - Microbiology 2024Quote: ... or OVA protein (InvivoGen) adjuvanted with 1 µg of monophosphoryl lipid A (MPLA ...
-
bioRxiv - Microbiology 2024Quote: ... or OVA protein (InvivoGen) was administered intravenously (iv. ...
-
bioRxiv - Immunology 2023Quote: ... The RBD-specific mAbs used in the competition ELISAs including the following: LY-CoV016/etesevimab (InvivoGen, cat. srbdc6-mab1); LY-CoV555/bamlanivimab (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 or Omicron BA.2 Spike expression vectors lacking the 19 C-terminal amino acids containing the ER-retention signal (InvivoGen plv-spike-v11 and plv-spike-v12). HEK293T cells (1.2×106 cells ...
-
bioRxiv - Immunology 2020Quote: Biological activity of laminarin in LamOVA conjugates was analyzed by ELISA using a soluble murine Fc-Dectin-1a receptor (InvivoGen). Hypoallergenicity was analyzed in vitro as a measure of rat basophil leukemia cell (RBL-2H3 ...
-
bioRxiv - Immunology 2023Quote: ... Pam3CSK4 (100 µg/mouse; InvivoGen), or Poly(I:C ...
-
bioRxiv - Immunology 2020Quote: ... clarified by centrifugation and subsequently incubated with Peptide M(Invivogen)/Protein G-coupled sepharose beads (Invivogen, catalog# gel-pdm-5 ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Microbiology 2022Quote: ... the HEK293T cells were transfected with 30 µg of expression plasmid encoding the SARS-CoV-2 Wuhan-Hu-1 S protein (pCAG3.1/SARS2-Sd19) or Delta variant S protein (pUNO1-SpikeV8; Invivogen) using FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Microbiology 2020Quote: ... with 50 μl/mouse of AddaVax (Invivogen) as the adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... or Poly(I:C) (100 µg/mouse; InvivoGen) in 200 µl PBS for 24 h ...
-
bioRxiv - Immunology 2021Quote: ... CD14 and CD163 implementing flow cytometry and by quantification of IL-10 and IL-12p40 secretion using ELISA following 24-hour stimulation in the presence or absence of 100 ng/ml of lipopolysaccharide (LPS; InvivoGen, San Diego, United States).
-
bioRxiv - Immunology 2023Quote: ... mice were injected with equal amounts of SARS-CoV-2 protein delivered as 1) soluble protein in conjugation with adjuvant (Alhydrogel, 100 µg/dose, vac-alu-250, InvivoGen), or 2 ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with equal amounts of SARS-CoV-2 protein delivered as 1) soluble protein in conjugation with adjuvant (Alhydrogel, 100 μg/dose, vac-alu-250, InvivoGen), or 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... irrelevant protein Ovalbumin (OVA, Invivogen, San Diego, CA) and PD1 as an internal negative control were coupled to distinct fluorescent-barcoded MagPlex microspheres (Luminex Corporation) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Full-length ovalbumin protein (#vac-pova, InvivoGen, USA) was added at 100 μg mL-1 to the cells and incubated for 20 h at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... or the mouse kappa light chain plasmid (InVivoGen). The gBlock DNA and plasmids were cut with the specified enzymes ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein vaccines were administered in combination with Alhydrogel (Invivogen) at a 1:9 v/v ratio of adjuvant to antigen ...
-
bioRxiv - Immunology 2022Quote: ... 5 μg HA protein combined with either Alum (InvivoGen) or AddaVax (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Microbiology 2023Quote: ... or 10 μg of protein adjuvanted with AddaVax (Invivogen)156,157 ...