Labshake search
Citations for Invivogen :
1 - 50 of 52 citations for L Phenylalanine N T Boc 13C9 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Parent Flp-In™ T-REx™-293 cells were additionally supplemented with 15 μg/ml blasticidin (InvivoGen, cat n°ant-bl-1) and 100 μg/ml zeocin for cultivation ...
-
bioRxiv - Neuroscience 2022Quote: ... puromycin (1 mg/L, Invivogen) was added to each media change the following two days ...
-
bioRxiv - Immunology 2022Quote: ... A549-hACE-TMPRSS2 (A549A/T) cells (InvivoGen, cat no. a549-hace2tpsa) were maintained in DMEM with 10%FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with L-Glutamine and Primocin (100mg/ml; InvivoGen) and maintained at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cloned into pFUSEss H and L vectors (Invivogen) using NEB HIFI assembly kit (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and then 0.2g/L Neomycin/G418 (InvivoGen, San Diego, CA) selection media was added ...
-
bioRxiv - Immunology 2020Quote: ... EV or Toll-like receptor–ligands (TLR-L) (InvivoGen, Toulouse, France): imiquimod (IMIQ ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... The HeLa T-Rex-Flp-In cell line was also supplemented with 100 μg/ml Zeocin (Invivogen) and 15 μg/ml of Blasticidin (Invivogen ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... We added 50mg/L Plasmocin™ prophylactic (Invivogen, San Diego, CA, USA) to both DMEM and RPMI media ...
-
bioRxiv - Microbiology 2023Quote: ... Penicillin/Streptomycin and 2mM L-Glutamine and 100 µg/ml primocin (Invivogen). The cells were harvested after 3-4 days when full cytopathic effect was observed ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... Jurkat T cells were electroporated as described below and clones were selected with 800 µg/mL G418 (InvivoGen) antibiotic for 7 passages.
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Cell Biology 2024Quote: Reagents used for treatment are as listed: ADP-heptose (tlrl-adph-l, InvivoGen), TNF (315-01A-5UG ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... 2×104 DCs were co-cultured for 3 days with 5×104 FACS sorted naïve OT-II CD4+ T cells in the presence of 1 µg/ml OVA peptide (OVA323-339, Invivogen) and 0.25 ng/ml TGFβ (recombinant mouse TGF-b1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombination cloning-compatible U2OS cells were generated using the Flp-In T-Rex Core Kit (Thermo) according to the manufacturer’s instructions and maintained under selection using Blasticidin (Invivogen) and Zeocin (Thermo) ...
-
bioRxiv - Neuroscience 2020Quote: Stably transfected HEK293 Flp-In T-Rex cells were grown and maintained in DMEM supplemented with 10% FBS and 100 µg/mL Hygromycin (InvivoGen) and 15 µg/mL Blasticidin (InvivoGen) ...
-
bioRxiv - Immunology 2022Quote: ... at a concentration of 1×106 T cells per well in RPMI medium supplemented with Primocin (100 µg/ml; Invivogen), 10 % charcoal stripped FBS (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were expanded to a surface-treated T-75 flask and treated with 2 µg/mL of puromycin (Invivogen) for 2 weeks for selection of the transduced cells to generate the cell line expressing hM3D(Gq) ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... OT-1 T-cells (5 × 104 cells/well) were co-cultured with 0.5 ng/mL SIINFEKL peptide (InVivoGen, # vac-sin)-pulsed splenocytes (5 × 104 cells/well ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated at 1×106 cells/mL T cell media plus 1 μg/mL phorbol myristate acetate (PMA) (Invivogen; tlrl-pma), 1μg/mL ionomycin (Calbiochem ...
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Two days post-transfection the media was replaced with DMEM containing 0.5% fetal bovine serum and NOD1 or NOD2 agonist [1 μg/ml C12-iE-DAP (Invivogen)+ 10 ng/ml human interferon gamma (AbD serotec) and 5 μg/ml L-18-MDP (InvivoGen) + 10 ng/ml human interferon gamma ...
-
bioRxiv - Immunology 2020Quote: ... T cell independent type 1 (TI-I) stimulation was mimicked by incubation with CpG OND Type B or R848 (InvivoGen, San Diego, USA). TI type 2 (TI-II ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2024Quote: ... were immunised IM with 10 µg N-half RIPR or 13 µg full-length RIPR protein formulated in AddaVax™ (Invivogen, France) on days 0 ...
-
bioRxiv - Cell Biology 2020Quote: ... on sterilized 5mm diameter metal tissue mounts and fixed in place with sterilized “O-rings.” Tissues were washed thoroughly in sterile PBS (0.01 mol L−1, pH 7.2) supplemented with Primocin (100mg/ml; InvivoGen) and maintained in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 10% Fetal Bovine Serum (FBS, Biowest) and 200 mM L-Glutamine (Biowest) in the presence of G418 (250 μg/ml, InvivoGen) and Hygromycin B Gold (50 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The supernatants were discarded before staining with 50 μL of 2 μg/mL secondary AF488 goat anti rabbit (goat IgG H+L, Invivogen) in cytometry buffer for 30 min on ice ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 μL cell supernatant was collected from each sample and added to 150 μL of QUANTI-Blue SEAP detection medium (InvivoGen) and incubated for 2 h at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 20 µl of cell supernatant were transferred to new plates and supplemented with freshly made 180 µl Quanti-Blue solution (Invivogen, France). After 180 minutes of incubation ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μl of supernatants from the HEK-Blue™ or THP1-Blue™ cells were mixed with 180 μl of QuantiBlue reagent (InvivoGen) and optical density (O.D. ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 µL of cell culture supernatant was then withdrawn and analyzed for alkaline phosphatase content via change in Quanti-Blue (Invivogen, rep-qbs) absorbance at 620 nm (Spectramax id3 plate reader).
-
bioRxiv - Immunology 2022Quote: ... 4.5 g/L Glucose, 1 mM Sodium Pyruvate, 10% FBS (Thermo Fischer, Massachusetts, US) and 100 μg/ml Normocin (Invivogen, California, US). Cells were grown in Nunc™ 75cm2 culture flasks at a maximum of 2×106 cells/ml with 100 μg/ml of selective antibiotic Zeocin (Invivogen ...
-
bioRxiv - Physiology 2021Quote: ... Duodenal or jejunal segments (∼6 cm) were isolated and placed into falcon tubes containing cold DMEM (high glucose, 4.5 g/l) containing Primocin (Invivogen, cat# ant-pm-1). Intestinal epithelial cells were dissociated using a Gentle Cell Dissociation Reagent (Stemcell Technologies ...