Labshake search
Citations for Invivogen :
51 - 100 of 1107 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade B BH10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Human codon optimized Delta full-length SARS-CoV-2 Spike protein plasmid was synthesized by Invivogen (plv-spike-v8).
-
bioRxiv - Immunology 2020Quote: ... Anti-human IgG Fc Capture (AHC) Biosensors tips were initially loaded with Dectin-1A:FC fusion protein (Invivogen, #fc-hdec1a) at 13 ug/ml ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Cell Biology 2022Quote: ... pUNO1-SpikeV8 carrying delta variant spike and pUNO1-SpikeV11 carrying omicron (B.1.1.529/BA.1 lineage) spike were purchased from InvivoGen (catalogue numbers p1-spike-v8 and p1-spike-v11 respectively).
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Pathology 2019Quote: Spleen B cells were isolated and stimulated in vitro (1×106 cell/mL) with 1µg/mL of LPS (InVivoGen) for four days ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein translation was inhibited with 50 µg·mL-1 of puromycin (ant-pr-1, Invivogen).
-
bioRxiv - Cell Biology 2020Quote: ... and selected with 100 μg/ml Hygromycin B (Invivogen) and 10 μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2021Quote: ... Class B (murine) (TLR9 agonist) were purchased from InvivoGen. PIKA ...
-
bioRxiv - Molecular Biology 2019Quote: ... plates included 200 µg/mL Hygromycin B Gold (InvivoGen) or 133 µg/mL Nourseothricin (Gold Biotechnology) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200μg/mL Hygromycin B Gold (Invivogen, #ant-hg) until they form colonies for ten to fourteen days ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Microbiology 2023Quote: ... selection was performed using 200μg/ml hygromycin B (InvivoGen) until only GFP positive cells remained ...
-
bioRxiv - Cell Biology 2019Quote: ... Stable transfectants were selected in medium containing 500 μg/ml hygromycin B (InvivoGen, cat. # ant-hg-1; San Diego, CA). Pools of resistant cell colonies were characterized for MT1-MMP expression by reverse transcription-PCR and Western blotting ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... wild-type BALB/c female mice were sensitized intraperitoneally twice at 7-day intervals with either PBS (Group A) or 40 μg of OVA (Group B-F) together with 1 mg of aluminum hydroxide adjuvant (InvivoGen) on day 0 and day 7 ...
-
bioRxiv - Microbiology 2022Quote: ... the HEK293T cells were transfected with 30 µg of expression plasmid encoding the SARS-CoV-2 Wuhan-Hu-1 S protein (pCAG3.1/SARS2-Sd19) or Delta variant S protein (pUNO1-SpikeV8; Invivogen) using FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Immunology 2023Quote: The human monocytic THP-1 cell line (ATCC TIB-202) and the THP-1 DualTM reporter cell (InvivoGen, Thpd-nfis) were culture in RPMI supplemented with 10% heat-inactivated fetal calf serum ...
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Physiology 2023Quote: The selection for virus-infected HDFs has performed with 4μg/ml blasticidin (Invivogen, San Diego, California) selection media ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5 mg/mL Hygromycin B (InvivoGen, San Diego, USA) to the complete DMEM (Miyoshi and Stappenbeck ...
-
bioRxiv - Immunology 2021Quote: ... Type B CPG ODN 2006 and R848 were from Invivogen. Antibodies anti-NF-κB p65 (D14E12) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/ml hygromycin B Gold (InvivoGen, ant-hg) to maintain the properties of the po- or c-DD-DAO Flp-In T-REx 293 stable cell lines ...
-
bioRxiv - Molecular Biology 2020Quote: ... to which 100 μg/mL of Hygromycin B Gold (Invivogen) was added for selection ...
-
bioRxiv - Immunology 2020Quote: ... B cells were stimulated with CpG ODN 1826 (1μM, Invivogen) in the presence of IL-2 (25U/ml ...
-
bioRxiv - Immunology 2023Quote: ... cells were stimulated with either 1µg/ml CpG B (Invivogen) or left unstimulated in complete media (RPMI1640 ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with equal amounts of SARS-CoV-2 protein delivered as 1) soluble protein in conjugation with adjuvant (Alhydrogel, 100 µg/dose, vac-alu-250, InvivoGen), or 2 ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with equal amounts of SARS-CoV-2 protein delivered as 1) soluble protein in conjugation with adjuvant (Alhydrogel, 100 μg/dose, vac-alu-250, InvivoGen), or 2 ...
-
bioRxiv - Immunology 2022Quote: ... The protein antigen was adjuvanted with AddaVax (1:1 v/v; vac-adx-10, InvivoGen, USA) for immunisation.
-
bioRxiv - Immunology 2020Quote: OT-1 splenocytes were activated with 20 μg/ml OVA protein (Invivogen) and 100 U/ml hIL-2 (Miltenyi Biotec ...
-
bioRxiv - Immunology 2022Quote: ... 1 mg/mL of whole OVA protein (Invivogen, San Diego, CA, USA) or γ-irradiated and CFSE stained B16F10 melanoma cells were added to the culture ...
-
bioRxiv - Molecular Biology 2021Quote: ... GFP only) were cultured in the same medium and selected by adding 100 μg/ml of hygromycin B (InvivoGen, ant-hg-1) to the media ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2020Quote: ... RBD or OVA proteins were formulated in PBS at a 1:1 ratio with Addavax adjuvant (InvivoGen). C57BL/6 or BALB/c mice were anesthetised by isoflurane inhalation prior to intramuscular injection of 50 μL vaccine in each hind quadriceps ...
-
bioRxiv - Cancer Biology 2021Quote: ... and were selected with 400 µg/ml hygromycin B GoldTM (Invivogen). Recombinant His-tagged proteins were purified from cell lysates on a nickel-chelating column (Ni-nitrilotriacetic acid agarose ...