Labshake search
Citations for Invivogen :
1 - 50 of 203 citations for Granzyme B GZMB Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... HEK293-hTLR7 (Invivogen hkb-htlr7), HEK-Lucia™ hRIG-I (Invivogen hkl-hrigi) ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293-hTLR9 (Invivogen hkb-htlr9), the corresponding parental HEK293 null1 (InvivoGen hkb-null1) ...
-
bioRxiv - Microbiology 2023Quote: HEK293-hTLR9 (Invivogen hkb-htlr9) and the corresponding parental HEK293 null1 (InvivoGen hkb-null1 ...
-
bioRxiv - Genomics 2020Quote: HEK293/hTLR4A-MD2-CD14 Cells (Invivogen) were selected for functional follow up of the IRF1 trans-eQTL because of the ease of transfection of HEK293 cells and the addition of the TLR4 receptor ...
-
bioRxiv - Immunology 2021Quote: ... Hek293/hTLR4-HA cells (InvivoGen#293-htlr4ha) were a gift from Guang Yang (Jinan University).
-
bioRxiv - Microbiology 2022Quote: HEK293 (HEK-Blue™ reporter cells, InvivoGen) -IFN-α/β and -IFN-λ cells were cultivated in DMEM (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Human Embryonic Kidney HEK293-Null2 cells (Cat #hkb-null2) and HEK293-hTLR4 cells (Cat #hkb-htlr4) were obtained from Invivogen and are isogenic reporter cell lines ...
-
bioRxiv - Microbiology 2022Quote: ... the corresponding parental HEK293 null1 (InvivoGen hkb-null1), HEK293-hTLR7 (Invivogen hkb-htlr7) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 and TMPRSS2a (Invivogen) were seeded at 20,000 cells/well in a gelatin-coated 96-well plate (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... and the corresponding parental HEK293 null1 (InvivoGen hkb-null1) cell lines were grown in DMEM media supplemented with 10% heat-inactivated FBS and 1X GlutaMAX (Life Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... we used engineered HEK293 cell lines (HEK-Blue) that stably express either mouse TLR9 (mTLR9) and an NF-κB reporter gene (Invivogen, San Diego, CA). In brief ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Systems Biology 2020Quote: ... HEK293 or U2OS cells were treated with 10 μM MG132 (InvivoGen) at approximately 80% confluence for 4 h and successively harvested ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Immunology 2022Quote: ... Reporter IFNγ (GAS) and ISG (IRF) HEK293 cell lines were purchased from Invivogen and expanded in DMEM supplemented with 10% heat inactivated FBS and selection antibiotics per vendor instructions.
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Microbiology 2021Quote: ... 20 µl HEK293 culture supernatant was added to 180 µl QUANTI-Blue reagent (InvivoGen) and incubated at 37°C for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: HEK293 cells expressing murine TLR2 or human TLR4 and CD14/MD2 were purchased from InvivoGen. Cells were cultured in the presence of blasticidin (Nacalai Tesque ...
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Immunology 2022Quote: ... ALPK1 knockout and TIFA knockout HEK293 cells and their parental cell line were purchased from Invivogen and termed HEK293 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...