Labshake search
Citations for Invivogen :
101 - 150 of 188 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The transgenic P0s were singled and their progeny were selected with 5mg/mL hygromycin B (InvivoGen). Viable F2s were further screened using a fluorescence stereomicroscope and PCR-based genotyping to verify knock-in alleles ...
-
bioRxiv - Cell Biology 2019Quote: ... XPO1 inhibition was carried on by incubating cells with 2.5 ng/ml Leptomycin B (LMB, InvivoGen) for up to 3 hours ...
-
bioRxiv - Immunology 2022Quote: ... Class B CpG oligonucleotide 1826 and polyinosinic-polycytidylic acid (Poly(I:C) HMW) were purchased from InvivoGen.
-
bioRxiv - Immunology 2022Quote: ... in the presence of 400□μg/mL hygromycin B and 1□mg/mL G418 (both InvivoGen), respectively.
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-NF-κB_luc were supplemented for routine growth with 50 µg/mL Hygromycin B (Invivogen, USA) in the same culture medium ...
-
bioRxiv - Immunology 2023Quote: ... with a single dose of CpG (ODN 1826, Class B CpG oligonucleotide, InvivoGen Cat#tlr-1826) 5 ug/mouse and DOTAP (DOTAP liposomal transfection reagent ...
-
bioRxiv - Neuroscience 2020Quote: ... because we were not able to identify a specific shRNA target sequence using web-based design tools (InvivoGen siRNA Wizard ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Immunology 2021Quote: Stimulations were done with 0.5μM CpG-ODN 2216 (Class A) or CpG-ODN 2006 (Class B) (Invivogen), 1μg/mL R848 (Invivogen) ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... they were subjected to a selection process by maintaining them in the presence of a suitable selection reagent (1μg/ml blasticidine [#ant-bl, Invivogen], 0.5μg/ml Puromycin [#ant-pr, Invivogen], 200μg/ml hygromycin B gold [#ant-hg, Invivogen]). After 10-14 days of this process ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Bioengineering 2023Quote: ... fused with the cDNA sequence of the human hinge and IgG1 heavy chain Fc region (pFUSE-hIgG1-Fc1, InvivoGen), downstream of a mouse Ig kappa chain secretion signal peptide ...
-
bioRxiv - Bioengineering 2023Quote: ... fused with the cDNA sequence of the mouse hinge and IgG2a heavy chain Fc region (pFUSE-mIgG2a-Fc1, InvivoGen), downstream of a mouse Ig kappa chain secretion signal peptide and was subcloned into a pMSGV retroviral vector followed by enhanced (e)GFP reporter gene cassette using PCR and standard molecular cloning techniques to generate pMSGV-A4-Fc-T2A-eGFP ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Microbiology 2020Quote: ... For selection in the presence of resistance markers 50 µg·mL-1 of hygromycin B or 100 µg·mL-1 of pyrithiamine (InvivoGen) were applied ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell pools stably recombining and expressing E3s were selected by resistance to Hygromycin B (100 μg/ml, InvivoGen). All Flp-In™293 cell lines were cultured in DMEM (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... pUNO1-SpikeV8 carrying delta variant spike and pUNO1-SpikeV11 carrying omicron (B.1.1.529/BA.1 lineage) spike were purchased from InvivoGen (catalogue numbers p1-spike-v8 and p1-spike-v11 respectively).
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cell transfection and infection of target cells was performed by Calcium Chloride followed by hygromycin B (InvivoGen) 0.5 mg/mL selection for 8 days.
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Immunology 2021Quote: The variable heavy and light chain sequences of 6F12 were cloned into the EcoRI/NheI sites of pFUSEss-CHIg-mG2a (D265A, Invivogen) and the EcoRI/BstAPI sites of pFUSE2ss-CLIg-mk (Invivogen ...
-
bioRxiv - Cell Biology 2020Quote: We generated dual expression barcoding vectors by inserting pairs of barcoding protein sequences into the pVITRO1-hygro-mcs plasmid (InvivoGen), which contains two multiple cloning sites MCS1 and MCS2 (Supplementary Fig ...
-
bioRxiv - Microbiology 2020Quote: ... we cloned the human IgG1 heavy chain (hG) and kappa light chain (hK) constant regions (sequences as present in pFUSE-CHIg-hG1 and pFUSE2-CLIg-hk; Invivogen) in the XbaI-AgeI cloning site of the pcDNA34 vector (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa Flp-In TRex cells expressing GFP-Astrin variants cells were maintained in medium supplemented with 200μg/ml Hygromycin B (Invivogen) and 4μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Pathology 2019Quote: Spleen B cells were isolated and stimulated in vitro (1×106 cell/mL) with 1µg/mL of LPS (InVivoGen) for four days ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable transfectants were obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/ml Hygromycin B Gold (Invivogen). All live imaging was performed in Leibovitz’s L-15 medium (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... FO B cells were sorted (the gating strategy is shown in Figure S4A) and stimulated with 2.5 µM CpG (InvivoGen) and nicotine (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... a clonal 9xKO-hSTGAL1-expressing CHO parent was made to express human A1AT via transfection with a plasmid containing the coding sequence of human alpha-1-antitrypsin (hA1AT) (GenBank NP_000286.3) under a composite promoter mCMV-hEF1-HTLV (InvivoGen, San Diego, CA) in a pcDNA3.1/Zeo(+ ...
-
bioRxiv - Microbiology 2022Quote: ... five different pseudotypes were generated using expression plasmids of respective spike variants: for prototype B.1/D614G as before (1) or sourced from Invivogen for VOCs Beta (Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2021Quote: ... Stable expression of the constructs in the HEK 293 cells was maintained by selection with hygromycin B (250 μg/ml final; Invivogen). For experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... Stable transfectants were selected in medium containing 500 μg/ml hygromycin B (InvivoGen, cat. # ant-hg-1; San Diego, CA). Pools of resistant cell colonies were characterized for MT1-MMP expression by reverse transcription-PCR and Western blotting ...
-
bioRxiv - Immunology 2022Quote: Splenic B cells were isolated from WT and cKO mice and cultured in presence of LPS (InvivoGen, San Diego, CA) 5 µg/ml or 1 µg/ml for 2 ...
-
bioRxiv - Biochemistry 2022Quote: ... hACE2- and S-expressing cells were maintained in hygromycin medium (complete growth medium supplemented with 100 μg/mL hygromycin B [Invivogen]) and puromycin medium (complete growth medium supplemented with 1 μg/mL puromycin [Invivogen]) ...
-
bioRxiv - Immunology 2022Quote: PBMCs were differentiated into memory B cells by incubating them with 500 ng/mL R848 (Invivogen, San Diego, CA, USA) and 5 ng/mL rIL-2 (R&D ...
-
bioRxiv - Microbiology 2022Quote: ... with 10 μg of A/Michigan/45/15 (N1) or B/Malaysia/2506/04 NA adjuvanted with 10 μg of poly(I⋅C) (Invivogen). Four weeks after the prime ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines transfected with the pMOT-4H plasmid (Oberholzer et al 2006) were grown with 25 ug/ml of hygromycin B Gold (Invivogen).
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 48-72h the medium containing viruses was replaced with fresh media with 1 μg/mL Puromycin or 1 μg/mL Hygromycin B Gold (InvivoGen), used for selection.
-
bioRxiv - Immunology 2023Quote: ... wild-type BALB/c female mice were sensitized intraperitoneally twice at 7-day intervals with either PBS (Group A) or 40 μg of OVA (Group B-F) together with 1 mg of aluminum hydroxide adjuvant (InvivoGen) on day 0 and day 7 ...
-
bioRxiv - Microbiology 2024Quote: ... NF-κB activity was monitored by the production of secreted embryonic alkaline phosphatase (SEAP) through the hydrolysis of HEK-Blue (InvivoGen). Optical density was read at 650 nm using a SpectraMax340 PC plate reader (Molecular Devices).
-
bioRxiv - Microbiology 2024Quote: For selection in the presence of resistance markers 50 μg ml−1 of hygromycin B or 100 μg ml−1 of pyrithiamine (InvivoGen) were added to the AMM in the growth plates.
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies used: Mouse anti-HA antibody (InvivoGen, 1:1000), rabbit anti-ACP (1:2000) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Strains containing the pHK-Cre-EBDh were selected on YDP agar plates supplemented with 200 µg/mL hygromycin B (Invivogen, USA).
-
bioRxiv - Immunology 2023Quote: ... To produce pseudoviruses expressing the S protein from different variants the following plasmids were used: Alpha (B.1.1.7) (InvivoGen, plv-spike-v2); Beta (B.1.351 ...