Labshake search
Citations for Invivogen :
101 - 150 of 218 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... The organoids were cultured in IMDM medium containing 20% FBS supplemented with antibiotics and normocin (Invivogen) for 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant RBD protein containing a C-terminal 6xHis tag was formulated with the Alhydrogel adjuvant (Invivogen) and each vaccine dose contained 5 μg of RBD and 500 μg of aluminum hydroxide ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transiently transfected with an NF-κB containing reporter construct plasmid (pNifty-Luc™, InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... and containing 10 µg·mL−1 blasticidin and 100−1 µg·mL zeocin (InvivoGen, San Diego, CA, USA), for selection of cells expressing NF-κB-SEAP and IRF-Luc reporters.
-
bioRxiv - Cell Biology 2022Quote: ... Stable cell lines were selected by culturing cells in medium containing 2.5 μg/ml phleomycin (InvivoGen) and/or 10 μg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng mL-1 full-length flagellin (FFLG) (containing 0.01% sucrose; tlrl-pstfla; Invivogen, CA, USA); 50 µg mL-1 lipooligosaccharides (LOS ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested 24 hours later and plated in medium containing 1 µg/ml Puromycin (InvivoGen) to select for transduced cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Cell Biology 2024Quote: ... The cell line was maintained as above in medium containing 5 µg/ml of blasticidin (Invivogen) and 100 µg/ml of hygromycin B (Invivogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultures were maintained in media containing 50% WRN conditioned media supplemented with 1mg/mL primocin (InvivoGen), 1mM N-Acetylcysteine ...
-
bioRxiv - Cell Biology 2024Quote: ... 800ng-1μg of RNA was reverse transcribed in a mix containing M-MLV reverse transcriptase (Invivogen), dNTP mix (Biobasic) ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TLR2 blocking antibodies (10μg/ml, Invivogen), or corresponding isotype controls (10μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... cells were sorted in wells pre-seeded with human CD40 ligand-expressing MS40L cells (5,000 cells/well) and containing 2.5µg/ml CpG ODN2006 (tlrl-2006; InvivoGen), 5µM CHK2 kinase inhibitor II ...
-
bioRxiv - Biochemistry 2022Quote: ... and stably integrated cells were selected and maintained in media containing either zeocin (100 μg/mL; Invivogen), puromycin (500 ng/mL ...
-
bioRxiv - Immunology 2019Quote: ... before being cultured for indicated time points in FCS-free medium containing 1 µg/ml LPS (Invivogen), 1 μg/ml synthetic (B ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were trypsinized and re-plated in media containing 100 µg/mL hygromycin (InVivogen, ant-hg-1) to begin selection ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293T cells were transfected with mscv2.2 vectors containing human or murine NLRC4 were using lipofectamine 2000 (Invivogen). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and PRR expression was maintained by growing the cells in media containing Blasticidin (ant-bl-05, InvivoGen), Zeocin (ant-zn-05 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transduced with lentiviral constructs containing the reporter and cells were then selected with hygromycin (Invivogen) for one week ...
-
bioRxiv - Genomics 2019Quote: WI-38 fibroblasts (purchased from ECCAC) were cultured in Dulbecco’s Modified Eagle’s medium (DMEM) containing 10% FBS and 1X Primocin (Invivogen) at 37°C and 3% oxygen ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Genomics 2021Quote: ... Cells were selected with 60% BRL conditioned medium containing 0.8 µg/mL puromycin for the Tir1 knock-in and 2.5 µg/mL blasticidin (Invivogen) for the AID-Dam knock-in lines ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cells were then transferred to the new YEA agar plate containing antibiotics [100 μg/mL G418 (InvivoGen) or 100 μg/mL nourseothricin (Gold Biotechnology)] and incubated at 32°C for at least 3 days to select the transformants ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Neuroscience 2021Quote: ... 67 or 1.6 µg of TLR2 antibody (Invivogen) or the same amount of IgG negative control antibody (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... normal rat PAb IgG control blocking antibodies (InvivoGen), Dexamethasone (10µM ...
-
bioRxiv - Immunology 2021Quote: ... were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen, San Diego, USA). Surviving cells were expanded and referred to as HEK293 luciferase reporter cells.
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2021Quote: ... Two days post-transfection the media was replaced with DMEM containing 0.5% fetal bovine serum and NOD1 or NOD2 agonist [1 μg/ml C12-iE-DAP (Invivogen)+ 10 ng/ml human interferon gamma (AbD serotec ...
-
bioRxiv - Immunology 2022Quote: Mice were injected subcutaneously with a total volume of 200ul containing 100ug TRP2180-188 peptide and 50ug poly(I:C) (InvivoGen) formulated in in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... filtered through sterile miracloth and pipetted on a double selective PDA plate containing 0.1 M Tris pH 8 supplemented with 100 μg/ml hygromycin (Duchefa) and 100 μg/ml zeocin (InvivoGen). Double drug resistant colonies were selected after three days and monospored on a new plate supplemented with both drugs ...
-
bioRxiv - Immunology 2021Quote: ... Flow through sera was then applied to a gravity flow column containing 1 mL Peptide M-sepharose resin (InvivoGen) to purify IgA ...
-
bioRxiv - Genomics 2020Quote: ... These 4T1 cells were always kept in selection medium containing 10 µg/mL of blasticidin (ant-bl-05, Invivogen). When reaching 70% confluency ...
-
bioRxiv - Microbiology 2023Quote: ... cells were placed under drug selection in 10% FBS/RPMI containing 1 µg/ml puromycin (InvivoGen, Cat# ant-pr) or 6 ng/ml blasticidin (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... the first seven days in HAM F12K Complete containing antimicrobial agent for primary cells (Primocin, cat. ant-pm2, InvivoGen) (1:500 ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... The cells were maintained in RPMI-1640 containing 10% FBS and 1 µg/mL puromycin (InvivoGen, ant-pr-1). The THP-1 human monocytic cell line was purchased from ATCC and maintained in RPMI-1640 supplemented with 10% FBS and 55 µM beta-mercaptoethanol at 37°C with 5% CO2.
-
bioRxiv - Immunology 2023Quote: ... of filtered PAO1 supernatant or TSB and KGMTM-2 containing purified flagellin at 1μg/ml or vehicle (tlrl-pafla; from P. aeruginosa; InvivoGen) were used for treating hTCEpi cells for various durations as indicated in the figure legends.
-
bioRxiv - Developmental Biology 2024Quote: All cells were cultured in DMEM/F12 containing 10% FBS and Primocin (50 ng/ml) (InvivoGen, ant-pm-1). DPP4+ ...
-
bioRxiv - Cell Biology 2024Quote: ... Transduced clones were selected and maintained in a medium containing 20 μg/ml Blasticidin S (Invivogen, #ant-bl-05).
-
bioRxiv - Immunology 2023Quote: ... Control antibodies for RBD (InvivoGen, Cat No. srbd-mab12) and N (AcroBiosystems ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HRP-conjugated anti-human IgG Fc antibodies (Invivogen; 31413) were used for detection ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Immunology 2019Quote: ... PIGTKO and wild-type THP-1 cells were differentiated into adherent macrophages in complete RPMI 1640 medium containing 100 ng/ml phorbol 12-myristate 13-acetate (PMA; InvivoGen) for 3 hr ...
-
bioRxiv - Neuroscience 2021Quote: ... were a kind gift of David Pla-Martin and Francesc Palau 21 and were grown in growth medium containing 2 μg/ml puromycin (InvivoGen).
-
bioRxiv - Microbiology 2020Quote: ... The transduction media was then changed with fresh DMEM for 24 hours then the transduced cells were selected using DMEM containing 10 μg/mL Blasticidin (Invivogen) and 1 μg/mL Puromycin (Invivogen) ...