Labshake search
Citations for Invivogen :
1 - 50 of 81 citations for Anti Selenoprotein N Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies used: Mouse anti-HA antibody (InvivoGen, 1:1000), rabbit anti-ACP (1:2000) ...
-
bioRxiv - Immunology 2022Quote: ... Anti-TNF antibody (Invivogen htnfa-mab1) was evaluated by pre-treating for 1 hour before TNF-α challenge ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TLR2 blocking antibodies (10μg/ml, Invivogen), or corresponding isotype controls (10μg/ml ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HRP-conjugated anti-human IgG Fc antibodies (Invivogen; 31413) were used for detection ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... anti-TLR2-IgA and IgA control antibody were purchased from Invivogen. Anti-TLR5-Fc mouse was purchased from R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Immunology 2021Quote: ... MCA-OVA tumor bearing mice were treated with 200 µg of anti-mCTLA4-mIgG2a monoclonal antibody (Invivogen) or 200 µg of isotype control antibody (mouse IgG2a ...
-
bioRxiv - Immunology 2023Quote: The agonistic activity of anti-CD40 monoclonal antibodies was tested by stimulating HEK-Blue-CD40L™ (Invivogen) cells which harbor an NF-κB-inducible Secreted Embryonic Alkaline Phosphatase (SEAP ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... They were incubated overnight in blocking buffer solution with the primary Anti-mDectin-1-IgG antibody (1:50; cat# mabg-mdect, Invivogen) at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2024Quote: ... were immunised IM with 10 µg N-half RIPR or 13 µg full-length RIPR protein formulated in AddaVax™ (Invivogen, France) on days 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Parent Flp-In™ T-REx™-293 cells were additionally supplemented with 15 μg/ml blasticidin (InvivoGen, cat n°ant-bl-1) and 100 μg/ml zeocin for cultivation ...
-
bioRxiv - Cancer Biology 2021Quote: ... All TLR antibodies were from InvivoGen.
-
bioRxiv - Neuroscience 2021Quote: ... 67 or 1.6 µg of TLR2 antibody (Invivogen) or the same amount of IgG negative control antibody (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... normal rat PAb IgG control blocking antibodies (InvivoGen), Dexamethasone (10µM ...
-
bioRxiv - Immunology 2023Quote: ... Control antibodies for RBD (InvivoGen, Cat No. srbd-mab12) and N (AcroBiosystems ...
-
bioRxiv - Physiology 2022Quote: ... anti-Mincle (clone 6G5, Invivogen) or control isotype antibodies were added at the indicated concentration at the beginning of the differentiation ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-hPD-L1-hIgG1 (Invivogen), anti-hPD-L1-hIgG1 (N298A ...
-
bioRxiv - Immunology 2023Quote: ... anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control (eBioscience ...
-
bioRxiv - Immunology 2021Quote: ... For assays using neutralising antibodies to TLR2 (200μg/mL; Invivogen) or HCMV (500μg/ml ...
-
bioRxiv - Immunology 2021Quote: Antibody variable regions were cloned into expression plasmids from Invivogen (#pfusess-hchg1 ...
-
bioRxiv - Immunology 2021Quote: ... or 200 µg of isotype control antibody (mouse IgG2a, Invivogen) three times at days 6 ...
-
bioRxiv - Immunology 2023Quote: ... positive control antibodies for RBD (InvivoGen, Cat No. srbd-mab6) and N (GenScript ...
-
bioRxiv - Immunology 2021Quote: ... or anti-spike-RBD- mIgG2a (InvivoGen) were diluted in blocking solution and used as standards for the assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-hPD-L1-hIgG1 (N298A) (Invivogen), purified anti-CD24 clone SN3 (GeneTex) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Anti-PD1 (InvivoGen, pdl1-mab15-1) was injected intraperitoneally at 100 ng/g twice a week for two weeks ...
-
bioRxiv - Immunology 2021Quote: ... In some assays human anti-RBD (Invivogen) of known antibody concentration was used as standard ...
-
bioRxiv - Immunology 2021Quote: Anti-human CD20 murine IgG2a (hcd20-mab10, InvivoGen) and mouse anti-Biotin mIgG2a [3E6] (ab36406 ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×105 PBMCs and 4×104 autologous CD8+ T cells were incubated with either supernatants from engineered PCs or media containing recombinant anti-CD19 x anti-CD3 bispecific (Invivogen, bimab-hcd19cd3) or anti-CD33 x anti-CD3 bispecific (AMG 330 ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×103 control cells and 5×104 CD8+ T cells were incubated with either various dilutions of supernatants from genome-engineered cells or media containing various concentrations of recombinant anti-CD19 x anti-CD3 bispecific (Invivogen, bimab-hcd19cd3) for 48 hours (Figure 1F-H & 3G-I) ...
-
bioRxiv - Immunology 2021Quote: ... and 50 ug/mL blasticidin (Invivogen, anti-bl-1) at 37°C 5% CO2 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or HRP-conjugated anti-human IgG Fc (Invivogen; 31413). Proteins from transient transfections were either purified via His-tag or Protein A purification ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat Anti-Dectin-1 (1/200, InvivoGen mabg-mdect); Mouse Anti-6E10 (1/500 ...
-
bioRxiv - Genetics 2023Quote: ... 100 μg/mL Normocin anti-mycoplasma (InvivoGen #ant-nr-1), 100 IU penicillin and 100 μg/mL streptomycin (ThermoFisher Scientific #15140122 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of HRP-conjugated anti-human IgG Fc (Invivogen; 31413) diluted 1:5000 in blocking buffer was added to the plates and incubated at room temperature for 1hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg/sample of Trastuzumab (anti-HER2-Tra-hIgG1, InvivoGen) was added directly to the media before incubation with beads ...
-
bioRxiv - Immunology 2022Quote: ... mouse TLR2 neutralizing antibody monoclonal mouse IgG2a (C9A12) and control isotypes mouse IgG2a were from InvivoGen. Mouse TLR4/MD2 complex neutralizing antibody monoclonal rat IgGk clone MTS510 and control isotypes rat IgGk were from eBioscience™ Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... stimulated monocytes were partially pre-incubated with a neutralizing IL-1α antibody (1:1,000, Invivogen, USA) for 1h ...