Labshake search
Citations for Invivogen :
351 - 400 of 458 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... at 100 ng/ml or transfected with 5 μg/ml high molecular weight (HMW) PolyIC (Invivogen) using Liopfectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... After 18 h cells were mock-transfected or transfected with 5 μg/ml HMW PolyIC (Invivogen) using Lipofectamine 2000 (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... seeded at low density the day after transfection and selected with Ganciclovir (5 μg/mL, Invivogen) for one week ...
-
bioRxiv - Cell Biology 2024Quote: ... The cell line was maintained as above in medium containing 5 µg/ml of blasticidin (Invivogen) and 100 µg/ml of hygromycin B (Invivogen) ...
-
bioRxiv - Immunology 2024Quote: ... A separate set of mice were challenged intraperitoneally with 5 µg LPS (serotype O55:B5; Invivogen) serum was collected after 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Immunology 2021Quote: ... K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed the next day and subjected to puromycin selection (2µg/ml, Invivogen ant-pr-5) 48hrs later ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then selected with Blasticidin at 5 μg/mL and Puromycin (1 μg/mL, Invivogen, USA) to select for cells stably expressing both dCas9 and the sgRNAs ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were treated with 5 μg/mL puromycin (InvivoGen, San Diego, CA, USA, Cat# ant-pr-1). After 1 week of incubation ...
-
bioRxiv - Cell Biology 2024Quote: ... Flip-In T-Rex cells were maintained using hygromycin B (30 µg/mL, InvivoGen, ant-hg-5) and blasticidin (30 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... Serum flow-through was then passed through 1 mL of Peptide M agarose (InvivoGen, gel-pdm-5) affinity column in gravity mode ...
-
bioRxiv - Immunology 2024Quote: ... done in duplicate wells for each condition) were stimulated with 5 uM CpG-A (ODN 1585, Invivogen) or CpG-C (ODN 2395 ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the cells were treated with 400 µM FFA and 3 µM HSG4112 in the presence or absence of bafilomycin A1 (Invivogen, tlrl-baf1). Cellular localization of LC3B was observed using a Carl Zeiss Confocal LSM710 Meta microscope and the images were processed with the software supplied by the manufacturer (Carl Zeiss ...
-
bioRxiv - Immunology 2020Quote: ... with penicillin-streptomycin (100 units/mL) and activated using 3 µM CpG (ODN 7909) (tlrl-2006-1, Invivogen, San Diego, CA, USA). Cells were cultured in 200 µl medium for 1-8 days using round bottom 96-well plates ...
-
bioRxiv - Genomics 2019Quote: ... supplemented with 5% human platelet lysate (Cook Regentec, #G34936) and 50 µg/mL Primocin (InvivoGen, #ant-pm-1). hASCs were cultured in the same media composition until 70-80% confluency and detached using TrypLE Select (Life Technology ...
-
bioRxiv - Bioengineering 2021Quote: The vaccines contained a 10 µg dose of RBD and combinations of 5 µg Quil-A Adjuvant (Invivogen), 50 µg Resiquimod (R848 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Immunology 2020Quote: Resiquimod gill challenge was performed as previously described (33) using 5 μL of Resiquimod (0.5 mg/mL; Invivogen) applied to the gills for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... Stained cells were cultured for 5 days in BCM supplemented or not with CpG (ODN2006, 2,5µg/ml, Invivogen), or cocultured with MS40 cells expressing CD40L and cytokine cocktail (recombinant human BAFF (10 ng/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of the ligated construct were transferred to chemically competent E.coli GT115 cells (pir mutant strain, Invivogen) and spread on lysogeny broth (LB ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) primocin (InvivoGen, San Diego, CA) for 15 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Immunology 2019Quote: ... or PAL-CRID3 (0.001-100 µM) for 30 min and then stimulated with 5 μg mL−1 nigericin (Invivogen) for 30 min.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of SpK combined with either BCG (BCGSpK) or 100 μg of Alhydrogel (Alum) (Invivogen, California, USA, AlumSpK), or a combination of BCG (5×105 CFU) ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transfected with 100 ng/ml of the RIG-I agonist 5’ triphosphate hairpin RNA (3p-hpRNA, Invivogen) complexed to Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Cell Biology 2021Quote: Endogenously tagged cell lines were maintained in HMI-9 supplemented with 20 % (v/v) FCS at 37 °C in 5% C02 and maintained in 10 µg.mL-1 Blasticidin (InvivoGen). Parasite density was monitored using a haemocytometer.
-
bioRxiv - Immunology 2021Quote: ... uninfected animals were treated intratracheally with 0.5 μg/kg of body weight of 5-OP-RU and 100 μg of CpG ODN 2006 (InvivoGen) mixed with 10 mg/kg of body weight of either rhesus macaque IgG4 isotype control antibody (DSPR4 ...
-
bioRxiv - Immunology 2020Quote: ... of 5 μg of each mAb (αDEC-NS1, αDCIR2-NS1, αDEC or αDCIR2) together with 50 μg poly (I:C) (Invivogen), exactly as described in (17) ...
-
bioRxiv - Microbiology 2021Quote: ... adjuvanted with MPLA-AddaVax (Per animal: 5 μg MPLAs, InvivoGen, cat# vac-mpls; 50μL AddaVax, InvivoGen, cat#-adx-vac) in a 100 µl injection volume via the intramuscular route (50 µl per hind leg) ...