Labshake search
Citations for Invivogen :
151 - 198 of 198 citations for 7 Hydroxy 4 methylcoumarin 3 acetic acid succinimidyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Immunology 2023Quote: ... Adenosine 5’-triphosphate disodium salt (ATP, CAS: 987-65-5), poly(dA:dT), and nigericin (Nig, CAS: 28643-80-3) were from InvivoGen. Cross linker disuccinimidyl suberate (DSS ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Microbiology 2020Quote: ... thuringiensis-infected mice was intravitreally treated with the synthetic TLR2/4 inhibitor OxPAPC (Invivogen; 30 ng/μl) (WT+OxPAPC ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... mice were primed by intraperitoneal injection of low molecular weight Poly(I:C) (LMW, InvivoGen; 4 mg/kg) followed 6h later by intraperitoneal challenge with LPS (L2630 ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Immunology 2021Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Genetics 2020Quote: ... Cells were lysed using passive lysis buffer and the activity of the enhancer assessed using a Lucia QUANTI-Luc Gold Assay #3 luciferase kit (InvivoGen). Because of clear evidence of the response of the pGL4.74 Renilla normalisation control plasmid to PMA treatments and co-transfection with the EGR1 expression vector Lucia activity levels were normalised against quantitative PCR (qPCR ...
-
bioRxiv - Pathology 2019Quote: ... Confluent mIMCD-3 cells were serum deprived for 16 hours and then stimulated with 1µg/mL LPS (Invivogen, tlrl-3pelps). RNAs and proteins were extracted 24 hours after stimulation.
-
bioRxiv - Immunology 2021Quote: ... At the time of seeding 3 tumor fragments were additionally treated with either vehicle control (endotoxin-free water) or CpG ODN 2006 (InvivoGen) at 0.5ug/mL ...
-
bioRxiv - Immunology 2022Quote: ... immunization with 50 µg TNP-KLH prepared with 1/3 volume of either alum or aluminum hydroxide gel (alhydrogel, Invivogen); 20 µg recombinantly produced trimer-stabilized HA (see below ...
-
bioRxiv - Microbiology 2022Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Immunology 2023Quote: ... alongside 100 μg mIgG1 anti-CD40 mAb (3/23, mouse IgG1 generated in-house as described previously[29, 30]) and the indicated doses of DMXAA(Invivogen), ADU-S100 was obtained from Oxeltis(Montpellier ...
-
bioRxiv - Immunology 2023Quote: ... whole splenocytes from OT-1 mice were electroporated on day 3 after initial activation with 1 µg/mL OVA 257-264 peptide (InvivoGen), and cells were further expanded for 4 days with 200 U/mL rhIL-2 (NCI) ...
-
bioRxiv - Microbiology 2023Quote: ... S10-3 ITGB1 KO cells were transduced with pWPI-ITGB1 and selected in cDMEM supplemented with 400 μg/ml G418 (Invivogen). S10-3 WT cells were transduced with pTRIPZ-Rab5/7/11-GFP or EGFP-LAMP1 and selected in cDMEM supplemented with 2 μg/ml puromycin (Invivogen).
-
bioRxiv - Immunology 2023Quote: Immune responses were induced in 6-12-week-old male and female mice by subcutaneous immunization in the right FP with 5 μg (for HA experiments) or 10 μg (for hapten-carrier experiments) supplemented with 1/3 volume alhydrogel adjuvant (Invivogen). In S1pr2-Tomato mice ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 or Omicron BA.2 Spike expression vectors lacking the 19 C-terminal amino acids containing the ER-retention signal (InvivoGen plv-spike-v11 and plv-spike-v12). HEK293T cells (1.2×106 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Immunology 2021Quote: ... K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Cell Biology 2022Quote: ... the cationic lipid-based transfection reagent LyoVec and cyclic [G(2’,5’)pA(3’,5’)p] (2’3’-cGAMP) were obtained from Invivogen (San Diego, USA) and Lipofectamine2000 was obtained from ThermoFisher Scientific (Dreieich ...
-
bioRxiv - Immunology 2022Quote: ... for 3 hr followed by (flagellin isolated from P. aeruginosa, 2 or 5 µg/mL) for 3 hr using FLA-PA Ultrapure (InvivoGen, tlrl-pafla) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the cells were treated with 400 µM FFA and 3 µM HSG4112 in the presence or absence of bafilomycin A1 (Invivogen, tlrl-baf1). Cellular localization of LC3B was observed using a Carl Zeiss Confocal LSM710 Meta microscope and the images were processed with the software supplied by the manufacturer (Carl Zeiss ...
-
bioRxiv - Immunology 2020Quote: ... with penicillin-streptomycin (100 units/mL) and activated using 3 µM CpG (ODN 7909) (tlrl-2006-1, Invivogen, San Diego, CA, USA). Cells were cultured in 200 µl medium for 1-8 days using round bottom 96-well plates ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) primocin (InvivoGen, San Diego, CA) for 15 min at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Genetics 2023Quote: ... the following were added directly to worm plates 3 days after injection: HygR selection −100 ul of 20 mg/ml Hygromycin (HygroGold™ InvivoGen, San Diego, CA) or Hygromycin B ...
-
bioRxiv - Immunology 2021Quote: ... Mice (8 mice per group) were intramuscularly injected twice at four-week intervals with each VLPs (HA content=3 µg) with AddaVax™ adjuvant (Invivogen, San Diego, CA, USA) (Figure 2) ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) Primocin™ (InvivoGen, San Diego, CA; ant-pm-1) for 15 min at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: Human monocytes THP–1 cells were seeded at a density of 3×105 cells/ml and treated with 100 ng/ml phorbol myristate acetate (PMA, InvivoGen, San Diego, CA, Cat. No. tlrl-pma) for 24 hours for their differentiation to nascent (M0 ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 or 8 µg/ml) or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...