Labshake search
Citations for Invivogen :
551 - 600 of 1410 citations for 7 CHLORO 4 NITRO 5 PIPERIDINO 2 1 3 BENZOXADIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 µg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat Anti-Dectin-1 (1/200, InvivoGen mabg-mdect); Mouse Anti-6E10 (1/500 ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...
-
bioRxiv - Immunology 2021Quote: ... transfection reagent (vehicle) and 2 μg/ml or 10 μg/ml ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2021Quote: ... IgA+ cells were detected by addition of goat anti-human IgA F(ab’)2 (InVivoGen) followed by anti-goat IgG AlexaFluor 594 (Jackson Immunoresearch ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 2 μg/ml puromycin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot.
-
bioRxiv - Microbiology 2023Quote: ... 2 μg of M2ex3 antigen + 40 μg CpG (oligonucleotide 1826, a TLR9 agonist from InvivoGen), or 2 μg of M2ex3 + 40 μg STING agonist (2’3’-c-di-AM(PS)2(Rp,Rp) ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% advanced fetal bovine serum (FBS, Capricorn) and 2 µg/mL puromycin (InvivoGen). For AAV production ...
-
bioRxiv - Immunology 2023Quote: ... with 2% NuSerum medium (29) supplemented with Primocin (50 µg/ml, (InvivoGen, San Diego, CA), and retinoic acid (1 x 10−8 M ...
-
bioRxiv - Cancer Biology 2022Quote: ... We selected infected human cell lines with 1 mg ml-1 blasticidin (InvivoGen, #ant-bl-1) for 14 days or with 1 mg ml-1 puromycin (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the cells were treated with 400 µM FFA and 3 µM HSG4112 in the presence or absence of bafilomycin A1 (Invivogen, tlrl-baf1). Cellular localization of LC3B was observed using a Carl Zeiss Confocal LSM710 Meta microscope and the images were processed with the software supplied by the manufacturer (Carl Zeiss ...
-
bioRxiv - Cell Biology 2019Quote: ... and primocin (100 μg ml-1) (ant-pm-1, InvivoGen).
-
bioRxiv - Pathology 2023Quote: ... and 1% gentamycin (G418, Invivogen cat. no. ant-gn-1). Primary human aortic SMCs (hVSMCs) ...
-
bioRxiv - Cell Biology 2024Quote: ... and blasticidin (30 µg/mL, InvivoGen, ant-bl-1: 1). The expression of proteins was induced with tetracyclin (1 µg/mL ...
-
bioRxiv - Bioengineering 2021Quote: The vaccines contained a 10 µg dose of RBD and combinations of 5 µg Quil-A Adjuvant (Invivogen), 50 µg Resiquimod (R848 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Immunology 2020Quote: Resiquimod gill challenge was performed as previously described (33) using 5 μL of Resiquimod (0.5 mg/mL; Invivogen) applied to the gills for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... Stained cells were cultured for 5 days in BCM supplemented or not with CpG (ODN2006, 2,5µg/ml, Invivogen), or cocultured with MS40 cells expressing CD40L and cytokine cocktail (recombinant human BAFF (10 ng/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of the ligated construct were transferred to chemically competent E.coli GT115 cells (pir mutant strain, Invivogen) and spread on lysogeny broth (LB ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Infected cells were selected for by the addition of 2 μg/mL puromycin (InvivoGen; ant-pr). Expression was verified by SDS-PAGE and/or BN-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA), and cells were filtered and plated at a density of 100,000 cells/cm2 onto uncoated tissue-culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...