Labshake search
Citations for Invivogen :
1 - 50 of 1340 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Bay-11 (5µM, InvivoGen) or MG-132 (9.5µM ...
-
bioRxiv - Microbiology 2023Quote: ... S10-3 WT cells were transduced with pTRIPZ-Rab5/7/11-GFP or EGFP-LAMP1 and selected in cDMEM supplemented with 2 μg/ml puromycin (Invivogen).
-
bioRxiv - Genomics 2020Quote: ... The involvement of the NF-κB was tested using irreversible inhibitor Bay 11-7082 at 10 µM (Invivogen, CA, USA). The action of MAPK Kinases (MEK1 and MEK2 ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Immunology 2023Quote: ... wild-type BALB/c female mice were sensitized intraperitoneally twice at 7-day intervals with either PBS (Group A) or 40 μg of OVA (Group B-F) together with 1 mg of aluminum hydroxide adjuvant (InvivoGen) on day 0 and day 7 ...
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10% fetal bovine serum (FBS) and 10 µg/mL Hygromycin B (InvivoGen) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Cell Biology 2020Quote: ... One replicate received 1 μg/mL puromycin (Invivogen). After 3 days ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen) for transfected cells.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... or hygromycin B Gold (200 µg/ml, InvivoGen, Cat#: ant-hg-1) depending on expressed marker genes ...
-
bioRxiv - Neuroscience 2021Quote: ... one from Invivogen of high molecular weight (HMW ...
-
bioRxiv - Molecular Biology 2020Quote: ... and hygromycin B (InvivoGen) as described previously (35) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and hygromycin B (InvivoGen) at 37ºC and 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and hygromycin B (InvivoGen).
-
bioRxiv - Genomics 2021Quote: Hygromycin B Gold (100 mg/mL) was ordered from Invivogen (ant-hg-1). Selection was done with 450µg/mL hygromycin.
-
bioRxiv - Cancer Biology 2022Quote: ... in the presence of 650 µg/ml hygromycin B Gold (Invivogen, ant-hg-1). By using limiting dilution assay ...
-
bioRxiv - Microbiology 2020Quote: ... For selection in the presence of resistance markers 50 µg·mL-1 of hygromycin B or 100 µg·mL-1 of pyrithiamine (InvivoGen) were applied ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... CpG-B ODN #1826 (Invivogen) was used at 5 μg/ml for stimulation in all experiments.
-
bioRxiv - Molecular Biology 2020Quote: ... Successful integration was monitored by antibiotic selection with hygromycin B (100 µg ml−1, Invivogen) and blasticidin (5 µg ml−1 ...
-
bioRxiv - Immunology 2019Quote: ... Splenic B cells were stimulated with either 1 μg/ml LPS (LPS-EB Ultrapure, InvivoGen), 1 μg/ml LPS + 20 ng/ml IL4 (Recombinant Murine IL-4 ...
-
bioRxiv - Immunology 2019Quote: ... 1 μg/ml synthetic (B) form DNA analog poly(deoxyadenylic-deoxythymidylic) acid (poly(dA:dT)) (Invivogen) or 400 nM dsDNA containing GATC or Gm6ATC sequences ...
-
bioRxiv - Microbiology 2022Quote: ... with 10 μg of A/Michigan/45/15 (N1) or B/Malaysia/2506/04 NA adjuvanted with 10 μg of poly(I⋅C) (Invivogen). Four weeks after the prime ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 mg/kg anti-CTLA-4 (clone 9D9, cat. mctla4-mab10, InvivoGen). Antibodies were administered twice weekly for a maximum of four weeks.
-
bioRxiv - Immunology 2022Quote: ... and 250ug/mL Hygromycin B (InVivoGen)) ...
-
bioRxiv - Microbiology 2022Quote: ... five different pseudotypes were generated using expression plasmids of respective spike variants: for prototype B.1/D614G as before (1) or sourced from Invivogen for VOCs Beta (Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 48-72h the medium containing viruses was replaced with fresh media with 1 μg/mL Puromycin or 1 μg/mL Hygromycin B Gold (InvivoGen), used for selection.
-
bioRxiv - Microbiology 2024Quote: For selection in the presence of resistance markers 50 μg ml−1 of hygromycin B or 100 μg ml−1 of pyrithiamine (InvivoGen) were added to the AMM in the growth plates.
-
bioRxiv - Immunology 2022Quote: ... in the presence of 400□μg/mL hygromycin B and 1□mg/mL G418 (both InvivoGen), respectively.
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...