Labshake search
Citations for Invivogen :
51 - 100 of 1336 citations for 6H Indolo 2 3 b quinoxaline 6 aceticacid 9 chloro 2 1 4 methylphenyl ethylidene hydrazide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... a 2-day 1.5 μg/mL puromycin (InvivoGen, ant-pr-1) selection was performed ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1% Penicillin/Streptomycin and 0.1mg/mL Normocin (ant-nr-2, Invivogen). HEK-Blue selection (hb-sel Invivogen ...
-
bioRxiv - Genetics 2022Quote: ... supplemented with 100 μg ml−1 primocin (Invivogen, ant-pm-2), 10% BIT 9500 (Stemcell Technologies ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... blasticidin (2 μg/ml; # ant-bl-1; InvivoGen, San Diego, USA) was added to the medium to select for stably transduced SMDT1-V5 or GFP-V5 cells ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with 100 μg ml−1 primocin (Invivogen ant-pm-2), 10% BIT 9500 (Stemcell Technologies 09500) ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: ... transformants were selected with 1-2 ug/mL of puromycin (Invivogen #ant-pr-1), then a single colony was isolated in two rounds of dilution and colony picking.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by selection using 2 μg/ml of puromycin (Invivogen, 58-58-2) for 2–3 days starting from 2 days after infection ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Stable transfectants obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/mL Hygromycin B Gold (Invivogen, 31282-04-9). HeLa cells were cultured in DMEM supplemented with 10% Fetal Bovine Serum and Penicillin-streptomycin 100units/ml at 37°C with 5% CO2.
-
bioRxiv - Cancer Biology 2021Quote: ... for 10 days or 2 μg/mL puromycin (InvivoGen; #ant-pr-1) for 4 days to generate stable cell lines.
-
bioRxiv - Biochemistry 2022Quote: ... cells were selected with 2 μg/mL puromycin (Invivogen: ant-pr-1).
-
bioRxiv - Physiology 2023Quote: ... and 1% normocin antibiotic (ant-nr-2, Invivogen, San Diego, CA, USA) at 20% oxygen (5% CO2 ...
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Physiology 2019Quote: ... followed by treatment with either the mitogen-activated protein kinase kinases 1 and 2 (MEK1/2) inhibitor PD98059 (50 μM; InvivoGen, San Diego, CA, USA) to block ERK1/2 activation ...
-
bioRxiv - Immunology 2022Quote: ... or Alum (Alhydrogel 2%, InvivoGen) at 50% v/v at final volume of 30µl per dose ...
-
bioRxiv - Immunology 2020Quote: ... R848 (2 μg/mL, InvivoGen), CHIKV-LR at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Biochemistry 2023Quote: ... puromycin (2 µg/ml, InvivoGen), blasticidin (10 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Immunology 2023Quote: Spike proteins (2 μg/dose) were formulated with Alhydrogel 2% (InvivoGen, San Diego, CA, USA) as previously described (20) ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Microbiology 2023Quote: ... Omicron BA.1 and Omicron BA.2 were purchased from InvivoGen (Toulouse, France). SARS-CoV-2pp were generated as previously described ...
-
bioRxiv - Cancer Biology 2024Quote: ... A positive control of 2 µg/ml of Puromycin (InVivoGen, ant-pr-1) was included ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water.
-
bioRxiv - Pathology 2019Quote: ... 0.5mL primocin (Invivogen ant-pm-2), BDNF (10ng/mL ...
-
bioRxiv - Microbiology 2020Quote: ... with Primocin (InvivoGen, ant-pm-2), and then digested with Collagenase II (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... Blasticidin selection (2 μg/ml, InvivoGen) was started 2–4 days after plating of cells and picking of clones was started 10–14 days after nucleofection ...
-
bioRxiv - Bioengineering 2021Quote: ... and Alhydrogel adjuvant 2% (alum, InvivoGen) were used for vaccination studies ...
-
bioRxiv - Genomics 2021Quote: ... and 2 mg/ml puromycin (InvivoGen) were added 24h after infection ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... and normocin (ant-nr-2, Invivogen). We used the Flp-InTM-CHO to generate CHO-derived stable transgenic cell lines overexpressing either MANF or its mutants from a transcriptionally active locus ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg/mL puromycin (Invivogen) at 37°C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µg/ml of puromycin (InvivoGen) was added to select for infected cells ...
-
bioRxiv - Immunology 2020Quote: ... 2) lipopolysaccharide (LPS) (10ng/ml - InvivoGen); and 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X primocin (Invivogen, ANT-PM-2), 1X N2 and B27 supplements (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X normocin (Invivogen, ANT-NR-2), 1X primocin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... abbreviated P3CSK4 (2 pg/mL; Invivogen), or recombinant IFN-β (400 U/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Puromycin (2 μg/mL, InvivoGen), depending on the selection cassette present in the enhancer plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...