Labshake search
Citations for Invivogen :
351 - 400 of 1195 citations for 6H Imidazo 4 5 h quinolin 6 one 1 9 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 µg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat Anti-Dectin-1 (1/200, InvivoGen mabg-mdect); Mouse Anti-6E10 (1/500 ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Cancer Biology 2022Quote: ... We selected infected human cell lines with 1 mg ml-1 blasticidin (InvivoGen, #ant-bl-1) for 14 days or with 1 mg ml-1 puromycin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... and primocin (100 μg ml-1) (ant-pm-1, InvivoGen).
-
bioRxiv - Pathology 2023Quote: ... and 1% gentamycin (G418, Invivogen cat. no. ant-gn-1). Primary human aortic SMCs (hVSMCs) ...
-
bioRxiv - Cell Biology 2024Quote: ... and blasticidin (30 µg/mL, InvivoGen, ant-bl-1: 1). The expression of proteins was induced with tetracyclin (1 µg/mL ...
-
bioRxiv - Bioengineering 2021Quote: The vaccines contained a 10 µg dose of RBD and combinations of 5 µg Quil-A Adjuvant (Invivogen), 50 µg Resiquimod (R848 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Immunology 2020Quote: Resiquimod gill challenge was performed as previously described (33) using 5 μL of Resiquimod (0.5 mg/mL; Invivogen) applied to the gills for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... Stained cells were cultured for 5 days in BCM supplemented or not with CpG (ODN2006, 2,5µg/ml, Invivogen), or cocultured with MS40 cells expressing CD40L and cytokine cocktail (recombinant human BAFF (10 ng/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of the ligated construct were transferred to chemically competent E.coli GT115 cells (pir mutant strain, Invivogen) and spread on lysogeny broth (LB ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA), and cells were filtered and plated at a density of 100,000 cells/cm2 onto uncoated tissue-culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of SpK combined with either BCG (BCGSpK) or 100 μg of Alhydrogel (Alum) (Invivogen, California, USA, AlumSpK), or a combination of BCG (5×105 CFU) ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transfected with 100 ng/ml of the RIG-I agonist 5’ triphosphate hairpin RNA (3p-hpRNA, Invivogen) complexed to Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Biochemistry 2019Quote: ... coli NucC bound to 5’-pApA or cAAA in hanging drop format by mixing protein (8-10 mg/mL) in crystallization buffer plus 0.1 mM 5’-pApA (Invivogen) or cAAA 1:1 with well solution containing 17-24% PEG 3350 ...
-
bioRxiv - Immunology 2021Quote: ... uninfected animals were treated intratracheally with 0.5 μg/kg of body weight of 5-OP-RU and 100 μg of CpG ODN 2006 (InvivoGen) mixed with 10 mg/kg of body weight of either rhesus macaque IgG4 isotype control antibody (DSPR4 ...
-
bioRxiv - Immunology 2020Quote: ... of 5 μg of each mAb (αDEC-NS1, αDCIR2-NS1, αDEC or αDCIR2) together with 50 μg poly (I:C) (Invivogen), exactly as described in (17) ...
-
bioRxiv - Microbiology 2021Quote: ... adjuvanted with MPLA-AddaVax (Per animal: 5 μg MPLAs, InvivoGen, cat# vac-mpls; 50μL AddaVax, InvivoGen, cat#-adx-vac) in a 100 µl injection volume via the intramuscular route (50 µl per hind leg) ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 1E3 or 1E4 colony forming units of Vaccinia Western Reserve or 5 μg of Poly I:C (Invivogen) with or without 5μgof anti-CD40 (FGK4.5 ...
-
bioRxiv - Genomics 2021Quote: ... 50,000 PBMCs from each individual were incubated for 10 hours at 37C and 5% CO2 in either the presence or absence of LPS (0.1 ug/mL, Invivogen ultrapure LPS from E ...