Labshake search
Citations for Invivogen :
501 - 550 of 823 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 6-8 weeks old CM knock-in mice were injected intraperitoneally with polyinosinic–polycytidylic acid [poly (I:C)] (InvivoGen, tlrl-picw-250) at 14 mg/kg/dose every other day for a total of 7 doses ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected 24 h after transfection with either 10 μg·mL-1 Blasticidin S or 10 μg·mL-1 G418 (both InvivoGen). Gene disruptions were confirmed either by immunoblotting (forB- and forG- ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg/mL of blasticidin (InvivoGen).
-
bioRxiv - Immunology 2019Quote: ... and Poly(I:C) (10 μg/ml; InvivoGen) for 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 μg/ml poly(I:C) (HMW, Invivogen) or 1 μg/ml LPS (from Escherichia coli strain 0127:B8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg ml-1 blasticidin (InvivoGen) and independent clones obtained by limiting dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg mL-1 of Blasticidin (Invivogen) and 1000 μg mL-1 G418 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... selecting with 10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 10-15 µg mL-1 G418 (InvivoGen), 50 µg mL-1 hygromycin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Microbiology 2022Quote: ... About 6-8-week-old C57BL/6 mice were immunized with 20 µg (50 µl) purified antigen in PBS using Addavax (Invivogen, San Diego, CA) as the adjuvant ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... wildtype C57BL/6 were immunized by intraperitoneal injection of 5 µg Spike protein (5 µg, Bio-Techne) in presence of 10 µg CpG adjuvant (10 µg, ODN1826, Invivogen), followed by two reimmunization steps of 5 µg Spike protein in 10 µg CpG adjuvant every 15 days for a total of three immunizations.
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IL-10 cells were purchased from Invivogen (catalog no ...
-
bioRxiv - Biochemistry 2022Quote: ... K562s were transfected according to manufacturer’s protocol with EGFR using pre-packaged lentiviral particles (G&P Biosciences) and selected for EGFR expression by culture in 1 μg/mL puromycin (InVivoGen). K562s were transfected according to manufacturer’s protocol with CD20 using pre-packaged lentiviral particles (G&P Biosciences LTV-CD20 ...
-
bioRxiv - Immunology 2023Quote: ... HEK293-C34 cells were gifted by Y Matsuura at Osaka University and maintained in high-glucose DMEM (Nacalai Tesque) containing 10% FBS and 10 μg/mL blasticidin (solution) (InvivoGen, California, USA), and the exogenous expression of ACE2 and TMPRSS2 was induced by the addition of doxycycline hydrochloride (1 μg/mL ...