Labshake search
Citations for Invivogen :
51 - 100 of 789 citations for 6H Furo 2 3 b pyrrole 5 carboxylicacid 6 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2019Quote: ... at 37°C and 5% CO2 for 6 h (ex vivo culture) or treated with 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen) for 6 h (LPS stimulation) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Immunology 2022Quote: ... shControl and shLRBA HeLa cells were seeded at 0.3*106 cells in 6 well-plates followed by treatment for 16 h or 24 h with 5 μM of MG132 (InvivoGen) alone or in combination with 100 nM of Bafilomycin A1 for 3 h ...
-
bioRxiv - Immunology 2024Quote: ... C57BL/6 mice were immunized with Spike protein (5 µg, Bio-Techne) in presence of CpG adjuvant (10 µg, ODN1826, Invivogen) according to the immunization protocol in Figure 1 ...
-
bioRxiv - Genomics 2022Quote: ... After 2 to 6 minutes of gentle manual shaking in ice cold PBS with 1% (v/v) primocin (InvivoGen), the intestinal pieces were inspected microscopically (x100 magnification ...
-
bioRxiv - Biophysics 2021Quote: ... and 250 μg/ml Hygromycin B (Invivogen). After 2–3 weeks ...
-
bioRxiv - Immunology 2020Quote: ... B-glucan peptide (BGP) 100ug/mL (Invivogen), high mobility group box 1 (HMGB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Biochemistry 2022Quote: ... Hygromycin B-Gold (75 μg/mL; Invivogen), blasticidin (10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 3′3′-cGAMP (100 μM; InvivoGen), c-di-AMP (100 µM ...
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Cell Biology 2020Quote: ... Agonist were used as following concentrations: 5’ppp-dsRNA (2 μg/ml, tlrl-3prna, Invivogen) and 2’3’-cGAMP (10 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Adenosine 5’-triphosphate disodium salt (ATP, CAS: 987-65-5), poly(dA:dT), and nigericin (Nig, CAS: 28643-80-3) were from InvivoGen. Cross linker disuccinimidyl suberate (DSS ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transduced with retrovirus in the presence of 6 μg/ml protamine sulfate and selected with 5 ug/ml Blasticidin (InvivoGen #ant-bl-05) for 5 days.
-
bioRxiv - Immunology 2023Quote: Immune responses were induced in 6-12-week-old male and female mice by subcutaneous immunization in the right FP with 5 μg (for HA experiments) or 10 μg (for hapten-carrier experiments) supplemented with 1/3 volume alhydrogel adjuvant (Invivogen). In S1pr2-Tomato mice ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Immunology 2023Quote: ... anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control (eBioscience ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Cell Biology 2020Quote: ... and selected with 100 μg/ml Hygromycin B (Invivogen) and 10 μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2021Quote: ... Class B (murine) (TLR9 agonist) were purchased from InvivoGen. PIKA ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Molecular Biology 2019Quote: ... plates included 200 µg/mL Hygromycin B Gold (InvivoGen) or 133 µg/mL Nourseothricin (Gold Biotechnology) ...