Labshake search
Citations for Invivogen :
51 - 100 of 821 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 µl/ml primicin (Ant-pm-2, InvivoGen) at 37°C for 19 hours.
-
bioRxiv - Bioengineering 2022Quote: ... and 2 μl/ml primocin (Ant-pm-2, InvivoGen) at 37°C for 19 hours ...
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...
-
bioRxiv - Microbiology 2021Quote: ... 6-7 week-old BALB/c mice were ordered from Invivogen/Envigo and were allowed to acclimatize for 10 days prior to experimentation ...
-
bioRxiv - Immunology 2023Quote: ... and another 1 μg/ml of anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control were added to the wells after 2 days of co-culture.
-
Inhaled CpG increases survival and synergizes with checkpoint inhibition in lymphangioleiomyomatosisbioRxiv - Immunology 2023Quote: Mice received CpG class B (5 μg/10 μg) 2x/week (Invivogen, tlrl-1826-5), in 50 μL of PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transduced with retrovirus in the presence of 6 μg/ml protamine sulfate and selected with 5 ug/ml Blasticidin (InvivoGen #ant-bl-05) for 5 days.
-
bioRxiv - Cell Biology 2020Quote: ... Agonist were used as following concentrations: 5’ppp-dsRNA (2 μg/ml, tlrl-3prna, Invivogen) and 2’3’-cGAMP (10 μg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... or on solid YPD-agar (1% yeast extract, 2% peptone, 2% D-glucose, 2% agar) and selected with 100 µg/ml Zeocin® (InvivoGen). For small scale expression screening ...
-
bioRxiv - Immunology 2023Quote: ... TLR2/TLR1 ligand Pam3CSK4 and TLR2/6 ligand FSL-1 were from InvivoGen: All LPS were resuspended in sterile PBS 1x.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2019Quote: ... followed by selection using 2 μg/ml of puromycin (Invivogen, 58-58-2) for 2–3 days starting from 2 days after infection ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Immunology 2022Quote: ... irradiated splenocytes from naive C57Bl/6 mice were pulsed with 0.5mg/ml ovalbumin (InvivoGen). CD8+ T cells were isolated from the spleens of the vaccinated mice using CD8 magnetic microbeads (Miltenyi ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected and maintained for 6 days with 750 ng/µl Zeocin (Invivogen) until harvest on day 7.
-
bioRxiv - Immunology 2022Quote: ... or Alum (Alhydrogel 2%, InvivoGen) at 50% v/v at final volume of 30µl per dose ...
-
bioRxiv - Immunology 2020Quote: ... R848 (2 μg/mL, InvivoGen), CHIKV-LR at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... THP-1 Null 2 (InvivoGen), THP-1 Null 2 NLRP3 KO (InvivoGen ...
-
bioRxiv - Biochemistry 2023Quote: ... puromycin (2 µg/ml, InvivoGen), blasticidin (10 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Immunology 2023Quote: Spike proteins (2 μg/dose) were formulated with Alhydrogel 2% (InvivoGen, San Diego, CA, USA) as previously described (20) ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water.
-
bioRxiv - Pathology 2019Quote: ... 0.5mL primocin (Invivogen ant-pm-2), BDNF (10ng/mL ...
-
bioRxiv - Microbiology 2020Quote: ... with Primocin (InvivoGen, ant-pm-2), and then digested with Collagenase II (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... Blasticidin selection (2 μg/ml, InvivoGen) was started 2–4 days after plating of cells and picking of clones was started 10–14 days after nucleofection ...
-
bioRxiv - Bioengineering 2021Quote: ... and Alhydrogel adjuvant 2% (alum, InvivoGen) were used for vaccination studies ...
-
bioRxiv - Genomics 2021Quote: ... and 2 mg/ml puromycin (InvivoGen) were added 24h after infection ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... and normocin (ant-nr-2, Invivogen). We used the Flp-InTM-CHO to generate CHO-derived stable transgenic cell lines overexpressing either MANF or its mutants from a transcriptionally active locus ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg/mL puromycin (Invivogen) at 37°C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µg/ml of puromycin (InvivoGen) was added to select for infected cells ...
-
bioRxiv - Immunology 2020Quote: ... 2) lipopolysaccharide (LPS) (10ng/ml - InvivoGen); and 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X primocin (Invivogen, ANT-PM-2), 1X N2 and B27 supplements (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X normocin (Invivogen, ANT-NR-2), 1X primocin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... abbreviated P3CSK4 (2 pg/mL; Invivogen), or recombinant IFN-β (400 U/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Puromycin (2 μg/mL, InvivoGen), depending on the selection cassette present in the enhancer plasmid ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...