Labshake search
Citations for Invivogen :
51 - 100 of 1056 citations for 6 fluoro 1 4 fluorophenyl 7 4 methylpiperazin 1 yl 4 oxoquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... TLR2/TLR1 ligand Pam3CSK4 and TLR2/6 ligand FSL-1 were from InvivoGen: All LPS were resuspended in sterile PBS 1x.
-
bioRxiv - Immunology 2024Quote: ... and 3 μg mL−1 puromycin (InvivoGen, cat. no. ant-pr). Expi293F cells were maintained in Expi293 media in a shaking incubator at 37°C and 8% CO2.
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Immunology 2020Quote: ... the medium was supplemented with 3 μM puromycin (InvivoGen, #ant-pr-1). Then ...
-
bioRxiv - Immunology 2019Quote: ... 1 μg/ml synthetic (B) form DNA analog poly(deoxyadenylic-deoxythymidylic) acid (poly(dA:dT)) (Invivogen) or 400 nM dsDNA containing GATC or Gm6ATC sequences ...
-
bioRxiv - Immunology 2021Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Microbiology 2022Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... whole splenocytes from OT-1 mice were electroporated on day 3 after initial activation with 1 µg/mL OVA 257-264 peptide (InvivoGen), and cells were further expanded for 4 days with 200 U/mL rhIL-2 (NCI) ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... DF-1 chicken fibroblasts were stimulated with the synthetic TLR2/6 antagonist Pam2CSK4 (InvivoGen tlrl-pms) at a final concentration of 10 µg/ml for the indicated times prior to lysis or fixation ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 or 8 µg/ml) or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
bioRxiv - Immunology 2023Quote: ... with 50 μg of the Toll-like receptor (TLR)3 agonist polyinosinic-polycytidylic acid [poly (I:C)] (InvivoGen), 50 μg of the TLR7 agonist imiquimod (InvivoGen) ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were then selected with both 3 μg/mL puromycin (InvivoGen #ant-pr-1) and 10 μg/mL blasticidin (InvivoGen #ant-bl-1 ...
-
bioRxiv - Microbiology 2020Quote: ... then incubated with 1 µM okadaic acid 30 min before transfer onto transgenic IL-1R reporter cells (Invivogen). After 18 h ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were selected in culture medium supplemented with 3 µg/ml puromycin (Invivogen, ant-pr-1), and selection was completed for 48 h before cells were harvested ...
-
bioRxiv - Biochemistry 2024Quote: ... HeLa cells were then cultured under selection with 3 μg/mL puromycin (InvivoGen, ant-pr-1) for 48hr and then expanded before storing stocks in liquid nitrogen.
-
bioRxiv - Cancer Biology 2021Quote: ... 6-8 weeks old CM knock-in mice were injected intraperitoneally with polyinosinic–polycytidylic acid [poly (I:C)] (InvivoGen, tlrl-picw-250) at 14 mg/kg/dose every other day for a total of 7 doses ...
-
bioRxiv - Genomics 2022Quote: ... After 2 to 6 minutes of gentle manual shaking in ice cold PBS with 1% (v/v) primocin (InvivoGen), the intestinal pieces were inspected microscopically (x100 magnification ...
-
bioRxiv - Immunology 2020Quote: Neutrophils isolated from 4 healthy volunteers were plated at 50,000 cells per well and stimulated in duplicate with the following ligands for 1 hour: lipotechoic acid (LTA) 100ng/mL (Invivogen), LPS (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were selected with 3 μg/mL puromycin (InvivoGen, San Diego, CA, catalogue #ant-pr-1), 10 μg/mL blasticidin (InvivoGen ...
-
bioRxiv - Genomics 2022Quote: ... and incubated in fresh 3 mM EDTA in ice cold PBS with 1% (v/v) primocin (InvivoGen) for 40 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Transduced cells were selected with 3 μg/mL puromycin (InvivoGen, San Diego, CA, catalogue #ant-pr-1) for 3 days ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen) and 5 µg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) Primocin™ (InvivoGen, San Diego, CA; ant-pm-1) for 15 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... co-transfected cells were selected in culture medium supplemented with 3 μg/ml puromycin (Invivogen, ant-pr-1), until selection was complete after about 48 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg μl-1 primocin (Invivogen ant-pm-1), 20 mmol/L HEPES at pH 7.4 and 25 μmol/L cytochalasin D.
-
bioRxiv - Bioengineering 2024Quote: ... this clone was used to generate a stable pool harboring the human glycosyltransferase gene ST6GAL1 via transfection with a plasmid containing the coding sequence of human beta-galactoside alpha-2,6-sialyltransferase 1 isoform a (hSTGAL1) (GenBank NP_001340845.1) and expressed from a composite promoter mCMV-hEF1-HTLV (InvivoGen, San Diego, CA) in a derivative of pcDNA3.1(+ ...
-
bioRxiv - Neuroscience 2020Quote: ... polyinosinic:polycytidylic acid (Invivogen), Ionomycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... Lipoteichoic acid (Invivogen, LTA-BS ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Immunology 2021Quote: ... were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen, San Diego, USA). Surviving cells were expanded and referred to as HEK293 luciferase reporter cells.
-
bioRxiv - Microbiology 2020Quote: ... DNA ratio of 3:1 according to manufacturer’s instructions or with Poly(I:C) (LMW)/LyoVec™ (tlrl-picwlv, InvivoGen). The treatment was administered as indicated ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were harvested from the 24-well plate when confluent by trypsinizing and transferring to a single well of a 6-well plate in 2 mL of medium supplemented with 1 μg/mL puromycin (Invivogen ant-pr). Cells were trypsinized daily (typically 3 d ...
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 volume AddaVax (InvivoGen) as described previously (Beatty et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Primocin (Invivogen #ant-pm-1), 20% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2022Quote: ... phytohemagglutinin (Invivogen, 1 µg mL-1) and IL2 (150 IU mL-1).
-
bioRxiv - Microbiology 2024Quote: ... and 1:1 volume AddaVax (InvivoGen) as described previously (Beatty et al. ...