Labshake search
Citations for Invivogen :
1 - 50 of 1332 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 3′3′-cGAMP (100 μM; InvivoGen), c-di-AMP (100 µM ...
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen. EFV was purchased from Bristol-Myers Squibb.
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... Elution was performed with free 2′3′-cGAMP (100 μM; InvivoGen), 3′3′-cGAMP (100 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Cell Biology 2022Quote: ... 3- methyladenine (Invivogen), bafilomycin A1 (Invivogen) ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... Infected cells were selected using puromycin for 3 days (2 µg/ml, InvivoGen) or hygromycin B for 7 days (500 µg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Immunology 2020Quote: ... and selected with 4 μg mL−1 puromycin (InvivoGen) for two weeks.
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2024Quote: ... and 3 μg mL−1 puromycin (InvivoGen, cat. no. ant-pr). Expi293F cells were maintained in Expi293 media in a shaking incubator at 37°C and 8% CO2.
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2020Quote: ... the medium was supplemented with 3 μM puromycin (InvivoGen, #ant-pr-1). Then ...
-
bioRxiv - Microbiology 2021Quote: ... and puromycin (3 ug/mL) (InvivoGen). All cell lines were grown at 37°C in 5% CO2.
-
bioRxiv - Immunology 2022Quote: ... and puromycin (3 μg/mL) (InvivoGen). IFNAR KO A549 cells were generated by CRISPR-Cas9 ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µg/ml Blasticidin S (InvivoGen) and 0.5 µg/ml Puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3 μg/mL puromycin (Invivogen). For immunoblotting experiments ...
-
bioRxiv - Immunology 2021Quote: ... Labeled cells (0.5x106 cells/mL) were cultured for 2-3 days with 5 μg/mL R848 (InvivoGen), 50 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Molecular Biology 2021Quote: ... + 4 μg/ml Blasticidin (Invivogen). In order to knock-out SLX4 gene in these cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/μL Zeocin (Invivogen) were added to culture media ...
-
bioRxiv - Immunology 2022Quote: ... 3 μg/mL puromycin (Invivogen, CA, USA) and 0.1 mg/mL Normocin (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... a toll-like receptor 3 agonist (InvivoGen). Peptide doses of 50 ...
-
bioRxiv - Cell Biology 2022Quote: ... Selection with Puromicin (3 μg/ml; InvivoGen) started 72 h post infection ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...