Labshake search
Citations for Invivogen :
1 - 50 of 1331 citations for 6 Methyl 1 2 4 triazolo 4 3 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μg ml-1 puromycin (InvivoGen), and grown at 37 °C in an atmosphere containing 5% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Immunology 2020Quote: ... and selected with 4 μg mL−1 puromycin (InvivoGen) for two weeks.
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... + 4 μg/ml Blasticidin (Invivogen). In order to knock-out SLX4 gene in these cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/μL Zeocin (Invivogen) were added to culture media ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Physiology 2019Quote: ... and 4 µg/ml blasticidin (InvivoGen). Monoclonal cell lines were tested for robust expression of E2GFP and FaNaC by fluorescence microscopy and patch clamp electrophysiology ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: Hygromycin B (Invivogen, ant-hg-1), Penicillin-Streptomycin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... and hygromycin B (InvivoGen, ant-hg-1). To induce the expression of the integrated genes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg cGAMP (Invivogen, San Diego, Californien, USA), 4 µg c-di-UMP (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and assayed with QUANTI-Luc 4 reagent (Invivogen). Luminescence was read immediately with an Envision system.
-
bioRxiv - Immunology 2023Quote: ... selective medium containing Puromycin (4 μg/ml, InvivoGen) was added and after 7 days cells were sorted using FACS Aria (BD ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/mL) for 6 hr using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Miltenyi, 1000U/mL) and interleukin-4 (IL-4, Miltenyi, 1000U/mL) for 5 days before addition of lipopolysaccharide (LPS, Invivogen, 50 ng/mL) for 2 further days.
-
bioRxiv - Genomics 2022Quote: ... After 2 to 6 minutes of gentle manual shaking in ice cold PBS with 1% (v/v) primocin (InvivoGen), the intestinal pieces were inspected microscopically (x100 magnification ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable transformants were selected using 4 μg/mL Blasticidin (Invivogen) and individual colonies were picked ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg c-di-UMP (Invivogen, San Diego, Californien, USA) or mock-electroporated using a Gene Pulser Xcell Electroporation instrument (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2021Quote: HEK-Blue™ IL-4/IL-13 cells (InvivoGen, France) were cultured according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...