Labshake search
Citations for Invivogen :
1 - 50 of 578 citations for 6 Ethyl N N dimethyl 1H pyrrolo 2 3 b pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Immunology 2024Quote: ... or 2µg/mL 2’,3’-cGAMP (InvivoGen), or 2µg/mL poly(I:C ...
-
bioRxiv - Immunology 2022Quote: ... 3′3′-cyclic-di-AMP (3′3′ CDA) (Invivogen, cat. no. tlrl-nacda), 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 3′3′-cGAMP (100 μM; InvivoGen), c-di-AMP (100 µM ...
-
bioRxiv - Systems Biology 2021Quote: ... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2021Quote: ... 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen. EFV was purchased from Bristol-Myers Squibb.
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... Elution was performed with free 2′3′-cGAMP (100 μM; InvivoGen), 3′3′-cGAMP (100 μM ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Cell Biology 2022Quote: ... 3- methyladenine (Invivogen), bafilomycin A1 (Invivogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
bioRxiv - Genetics 2019Quote: ... For stable sgRNA and shRNA expression 3 days puromycin (2 μg/ml, Invivogen) selection was applied.
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... Infected cells were selected using puromycin for 3 days (2 µg/ml, InvivoGen) or hygromycin B for 7 days (500 µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Microbiology 2021Quote: ... and puromycin (3 ug/mL) (InvivoGen). All cell lines were grown at 37°C in 5% CO2.
-
bioRxiv - Immunology 2022Quote: ... and puromycin (3 μg/mL) (InvivoGen). IFNAR KO A549 cells were generated by CRISPR-Cas9 ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µg/ml Blasticidin S (InvivoGen) and 0.5 µg/ml Puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3 μg/mL puromycin (Invivogen). For immunoblotting experiments ...
-
bioRxiv - Immunology 2021Quote: ... Labeled cells (0.5x106 cells/mL) were cultured for 2-3 days with 5 μg/mL R848 (InvivoGen), 50 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Immunology 2022Quote: ... 3 μg/mL puromycin (Invivogen, CA, USA) and 0.1 mg/mL Normocin (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... a toll-like receptor 3 agonist (InvivoGen). Peptide doses of 50 ...
-
bioRxiv - Cell Biology 2022Quote: ... Selection with Puromicin (3 μg/ml; InvivoGen) started 72 h post infection ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Immunology 2023Quote: ... 3 hours before infection Pam3CSK4 (Invivogen, tlrl-pms) was spiked into the wells at a final of 100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Immunology 2020Quote: ... for 3 days with 0.5 μg/mL LPS (Invivogen) and 0.5 μg/mL anti-IgM F(ab’)2 (Jackson ImmunoResearch) ...
-
bioRxiv - Immunology 2022Quote: ... which were selected by blasticidin (3 μg/ml, InvivoGen) for 4 days prior to the experiments.
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were exposed to puromycin (3 μM final concentration, Invivogen) for 5 minutes or left untreated for control conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... the cationic lipid-based transfection reagent LyoVec and cyclic [G(2’,5’)pA(3’,5’)p] (2’3’-cGAMP) were obtained from Invivogen (San Diego, USA) and Lipofectamine2000 was obtained from ThermoFisher Scientific (Dreieich ...
-
bioRxiv - Immunology 2022Quote: ... for 3 hr followed by (flagellin isolated from P. aeruginosa, 2 or 5 µg/mL) for 3 hr using FLA-PA Ultrapure (InvivoGen, tlrl-pafla) according to the manufacturer’s protocol ...