Labshake search
Citations for Invivogen :
301 - 350 of 423 citations for 6 ETHYL 4 METHYL PYRAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibiotic selection was applied two days after transfection (2 μg/mL puromycin (#ant-pr-1, Invivogen) for 3 days).
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were transferred into 10 cm dishes and selected with 2 µg ml-1 puromycin (InvivoGen). After 7-10 days ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Immunology 2021Quote: ... Labeled cells (0.5x106 cells/mL) were cultured for 2-3 days with 5 μg/mL R848 (InvivoGen), 50 U/mL IL-2 (Peprotech) ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... MDDCs were harvested and cultured over-night in media alone or in the presence of 5 μg/ml of a pool of 15-mer overlapping HIV-1 Gag peptides provided by the NIH AIDS Reagent Program (#11057) either individually or in combination with 1 μg/ml of 2’3’-c’diAM(PS)2 (Invivogen) STING agonist and 2.5 μg/ml of Poly I:C (SIGMA ...
-
bioRxiv - Immunology 2021Quote: ... in a final volume of 100 µL X-VIVOTM-15 + 2% HS + 1 µg.mL-1 poly(I:C) (tlrl-picw, Invivogen). After 3 h ...
-
bioRxiv - Immunology 2021Quote: ... Specific wells were pre-cultured for 2 hours with either 10mg/ml of TLR4 inhibitor (CLI-095, Invivogen) or 10mg/ml PI3 Kinase inhibitor (LY294002 ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Microbiology 2023Quote: ... ACE2 and transmembrane serine protease 2 (TMPRSS2)-expressing A549 (ACE2-TMPRSS2-A549) cells were from Invivogen (#a549-hace2tpsa) and HEK293T were from ATCC (#CRL-11268) ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Biochemistry 2020Quote: ... parasites were cultured with anhydrotetracycline medium at 250 nM (aTc+, MilliporeSigma) for 2 days before blasticidin /aTc+ medium was used (blasticidin at 2.5 µg/mL, InvivoGen).
-
bioRxiv - Bioengineering 2022Quote: ... Human codon optimized Delta full-length SARS-CoV-2 Spike protein plasmid was synthesized by Invivogen (plv-spike-v8).
-
bioRxiv - Immunology 2021Quote: ... in the left and right mid-thighs with 50 µg MD39 and 500 µg alum (Alhydrogel adjuvant 2%; InvivoGen) per side ...
-
bioRxiv - Neuroscience 2021Quote: ... endotoxin levels in exosomes and iPS-Mg medium were measured using the HEK Blue LPS detection kit 2 (InvivoGen) following manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... experiments were grown in Dulbecco’s modified Eagle’s medium DMEM supplemented with 10% fetal bovine serum and 50ug/ml normocin (ant-nr-2, Invivogen). HEK293 cells and other cell lines used were grown at 37°C and 5% CO2.