Labshake search
Citations for Invivogen :
251 - 300 of 569 citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 200 µg/mL Hygromycin B (Invivogen) for selection during every second passage ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μM CpG B (ODN 2006, Invivogen), 1 μg/ml anti-CD40 (G28.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 200μg/mL Hygromycin B Gold (InvivoGen) for HEK-Dual TLR3 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Hygromycin B Gold (InvivoGen, ant-hg-1), GeneticinTM G-418 Sulphate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Beta (B.1.351) (InvivoGEn, plv-spike-v3) and Delta (B.1.617.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Biophysics 2024Quote: ... or Hygromycin B (InvivoGen, San Diego, CA) was added to the cell culture media in place of pen-strep to select for stably transfected cells ...
-
bioRxiv - Immunology 2021Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Genetics 2020Quote: ... Cells were lysed using passive lysis buffer and the activity of the enhancer assessed using a Lucia QUANTI-Luc Gold Assay #3 luciferase kit (InvivoGen). Because of clear evidence of the response of the pGL4.74 Renilla normalisation control plasmid to PMA treatments and co-transfection with the EGR1 expression vector Lucia activity levels were normalised against quantitative PCR (qPCR ...
-
bioRxiv - Pathology 2019Quote: ... Confluent mIMCD-3 cells were serum deprived for 16 hours and then stimulated with 1µg/mL LPS (Invivogen, tlrl-3pelps). RNAs and proteins were extracted 24 hours after stimulation.
-
bioRxiv - Immunology 2021Quote: ... At the time of seeding 3 tumor fragments were additionally treated with either vehicle control (endotoxin-free water) or CpG ODN 2006 (InvivoGen) at 0.5ug/mL ...
-
bioRxiv - Immunology 2022Quote: ... immunization with 50 µg TNP-KLH prepared with 1/3 volume of either alum or aluminum hydroxide gel (alhydrogel, Invivogen); 20 µg recombinantly produced trimer-stabilized HA (see below ...
-
bioRxiv - Microbiology 2022Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... alongside 100 μg mIgG1 anti-CD40 mAb (3/23, mouse IgG1 generated in-house as described previously[29, 30]) and the indicated doses of DMXAA(Invivogen), ADU-S100 was obtained from Oxeltis(Montpellier ...
-
bioRxiv - Microbiology 2023Quote: ... S10-3 ITGB1 KO cells were transduced with pWPI-ITGB1 and selected in cDMEM supplemented with 400 μg/ml G418 (Invivogen). S10-3 WT cells were transduced with pTRIPZ-Rab5/7/11-GFP or EGFP-LAMP1 and selected in cDMEM supplemented with 2 μg/ml puromycin (Invivogen).
-
bioRxiv - Immunology 2023Quote: Immune responses were induced in 6-12-week-old male and female mice by subcutaneous immunization in the right FP with 5 μg (for HA experiments) or 10 μg (for hapten-carrier experiments) supplemented with 1/3 volume alhydrogel adjuvant (Invivogen). In S1pr2-Tomato mice ...
-
bioRxiv - Immunology 2023Quote: ... whole splenocytes from OT-1 mice were electroporated on day 3 after initial activation with 1 µg/mL OVA 257-264 peptide (InvivoGen), and cells were further expanded for 4 days with 200 U/mL rhIL-2 (NCI) ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: ... transformants were selected with 1-2 ug/mL of puromycin (Invivogen #ant-pr-1), then a single colony was isolated in two rounds of dilution and colony picking.
-
bioRxiv - Microbiology 2021Quote: ... and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 1-2 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 μg/ml Bovine Serum Albumin (BSA) and 2 μg/ml Plasmocin (InvivoGen, USA). On day 18 ...
-
bioRxiv - Systems Biology 2022Quote: ... and cells were selected with 2 µg/mL puromycin (Invivogen, catalog # ant-pr-1) 96 hours post-transfection for 3 days ...
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Immunology 2019Quote: ... Cells were then washed 2 times followed by treatment with PMA (Invivogen; tlrl-pma) and 50ug/ml ionomycin (Invivogen ...
-
bioRxiv - Cell Biology 2021Quote: ... TANK-binding kinase 1 (TBK1) and IκB kinase ε (IKKε; BX795, 2 μM; Invivogen); receptor for advanced glycation end products (RAGE ...
-
bioRxiv - Genomics 2021Quote: ... followed by 48 hrs of puromycin selection (2 µg/ml, InvivoGen, San Diego CA), prior to experiments.
-
bioRxiv - Immunology 2022Quote: ... and then stimulated with 100µl of fresh medium containing 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... and then stimulated with 500µl of fresh medium containing 2’3’-cGAM(PS)2 (Invivogen) for 24 hours.
-
bioRxiv - Immunology 2023Quote: ... and positive cells were selected using 2 μg/mL puromycin (InvivoGen, ant-pr-1) for GFP and mCherry or 1 mg/mL G-418 solution (Roche ...
-
bioRxiv - Immunology 2021Quote: ... K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...
-
bioRxiv - Cell Biology 2020Quote: ... Agonist were used as following concentrations: 5’ppp-dsRNA (2 μg/ml, tlrl-3prna, Invivogen) and 2’3’-cGAMP (10 μg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... resiquimod (2 mg/kg of a 1 mg/ ml solution in PBS, Invivogen tlrl-r848), were administered subcutaneously on E12.5 between 9:00-11:00 am and their conditions were monitored to ensure that there was no sign of any severe sickness symptoms or abnormalities.