Labshake search
Citations for Invivogen :
1 - 50 of 62 citations for 6 Bromo N methylnicotinamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2023Quote: ... anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control (eBioscience ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 6 ug/mL blasticidine (Invivogen). 293T-Lα were cultured in DMEM medium (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Microbiology 2020Quote: ... Poly I:C (31852-29-6) was from InvivoGen.
-
bioRxiv - Microbiology 2024Quote: ... Poly(I:C) (31852-29-6) was from InvivoGen, France ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Immunology 2020Quote: ... FSL1 (TLR2/6; tlrl-fsl; Invivogen, 100 ng/ml), LPS 0111:B4 (TLR4 ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 ng/ml blasticidin (InvivoGen, Cat# ant-bl). Single-cell clones were isolated by the limiting dilution of the drug-resistant cell pool and expanded ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Mycoplasma testing within 6 months of use (InVivoGen). Cell lines were maintained in culture at 37°C in 5% CO2.
-
bioRxiv - Bioengineering 2022Quote: ... C57BL/6 mice were treated with 200ug poly(I:C) (Invivogen) for 2 days ...
-
bioRxiv - Microbiology 2021Quote: ... 6-7 week-old BALB/c mice were ordered from Invivogen/Envigo and were allowed to acclimatize for 10 days prior to experimentation ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/mL) for 6 hr using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and another 1 μg/ml of anti-hIL-6-IgG (Invivogen) or mouse IgG1 kappa Isotype Control were added to the wells after 2 days of co-culture.
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... TLR2/TLR1 ligand Pam3CSK4 and TLR2/6 ligand FSL-1 were from InvivoGen: All LPS were resuspended in sterile PBS 1x.
-
bioRxiv - Immunology 2022Quote: ... irradiated splenocytes from naive C57Bl/6 mice were pulsed with 0.5mg/ml ovalbumin (InvivoGen). CD8+ T cells were isolated from the spleens of the vaccinated mice using CD8 magnetic microbeads (Miltenyi ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected and maintained for 6 days with 750 ng/µl Zeocin (Invivogen) until harvest on day 7.
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Disease was induced between 6 and 10 weeks of age using 3 mg curdlan (InvivoGen) administered by intraperitoneal injection ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... DF-1 chicken fibroblasts were stimulated with the synthetic TLR2/6 antagonist Pam2CSK4 (InvivoGen tlrl-pms) at a final concentration of 10 µg/ml for the indicated times prior to lysis or fixation ...
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and cells were cultured for 24 hours before selection with 6 μg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Microbiology 2022Quote: ... Positive controls were conducted by the addition of 1.25 µg/mL triDAP 6 hpi (InvivoGen, Toulouse, France). Stimulation of NOD1 was measured at OD600 nm 18 hpi and 24 hpi (corresponding to treatment durations of 12 h and 18 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2024Quote: ... were immunised IM with 10 µg N-half RIPR or 13 µg full-length RIPR protein formulated in AddaVax™ (Invivogen, France) on days 0 ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells and 5×104 NALM-6 cells were plated with 0.5-1 ng/mL blinatumomab (Invivogen) and cytokine ...
-
bioRxiv - Immunology 2023Quote: Mice of the C57BL/6 genetic background (8 – 14 weeks old) were immunised with EndoFit Ovalbumin (OVA) (Invivogen) or SARS-CoV-2 RBD ...
-
bioRxiv - Molecular Biology 2021Quote: ... Parent Flp-In™ T-REx™-293 cells were additionally supplemented with 15 μg/ml blasticidin (InvivoGen, cat n°ant-bl-1) and 100 μg/ml zeocin for cultivation ...
-
bioRxiv - Immunology 2021Quote: 6-10 week old IFN-λ reporter mice were injected intravenously with sterile PBS or 100 µg polyI:C (InVivoGen). Splenocytes were harvested 6 hours after treatment ...
-
bioRxiv - Genomics 2022Quote: ... After 2 to 6 minutes of gentle manual shaking in ice cold PBS with 1% (v/v) primocin (InvivoGen), the intestinal pieces were inspected microscopically (x100 magnification ...
-
bioRxiv - Immunology 2023Quote: ... mice at 6-8 week of age were treated with 0.1-10 μg of LPS (InvivoGen, San Diego, CA) i.p ...
-
bioRxiv - Immunology 2021Quote: Female IL-1βK133R/K133R and littermate WT control mice aged 6-8 weeks were intra-peritoneally injected with 100 μg LPS (Ultra-pure, Invivogen) and euthanized 2 hours later ...
-
bioRxiv - Immunology 2022Quote: ... mice were stimulated with a single injection of 6-10 mg/kg LPS reconstituted in endotoxin-free LAL reagent water (Invivogen) and diluted in PBS for a total volume of 200 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Genomics 2019Quote: ... at 37°C and 5% CO2 for 6 h (ex vivo culture) or treated with 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen) for 6 h (LPS stimulation) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Cell Biology 2020Quote: ... 2.5nM WR99210 (Jacobus Pharmaceuticals, Princeton, NJ) was added 6-8hours post transfection for the pSLI construct and with blasticidinS (Invivogen) at 2 μg/ml for the pDC2 plasmid ...
-
bioRxiv - Immunology 2021Quote: ... inhibitors were added to the T cells cultured in 24-well stimulation plates at the following concentrations 6-8 hours prior to electroporation: ODN A151 (Invivogen): 5 µM ...
-
bioRxiv - Immunology 2022Quote: ... shControl and shLRBA HeLa cells were seeded at 0.3*106 cells in 6 well-plates followed by treatment for 16 h or 24 h with 5 μM of MG132 (InvivoGen) alone or in combination with 100 nM of Bafilomycin A1 for 3 h ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen) and 5 µg/ml blasticidin (InvivoGen) ...