Labshake search
Citations for Invivogen :
501 - 550 of 1263 citations for 6 4 Methoxyphenyl 2 oxo 1 2 dihydro 3 pyridinecarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... WT THP-1 cells or casp-1-/- THP-1 were purchased from Invivogen and grown in complete medium containing RPMI (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Genetics 2020Quote: ... Cells were lysed using passive lysis buffer and the activity of the enhancer assessed using a Lucia QUANTI-Luc Gold Assay #3 luciferase kit (InvivoGen). Because of clear evidence of the response of the pGL4.74 Renilla normalisation control plasmid to PMA treatments and co-transfection with the EGR1 expression vector Lucia activity levels were normalised against quantitative PCR (qPCR ...
-
bioRxiv - Pathology 2019Quote: ... Confluent mIMCD-3 cells were serum deprived for 16 hours and then stimulated with 1µg/mL LPS (Invivogen, tlrl-3pelps). RNAs and proteins were extracted 24 hours after stimulation.
-
bioRxiv - Immunology 2021Quote: ... At the time of seeding 3 tumor fragments were additionally treated with either vehicle control (endotoxin-free water) or CpG ODN 2006 (InvivoGen) at 0.5ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... alongside 100 μg mIgG1 anti-CD40 mAb (3/23, mouse IgG1 generated in-house as described previously[29, 30]) and the indicated doses of DMXAA(Invivogen), ADU-S100 was obtained from Oxeltis(Montpellier ...
-
bioRxiv - Microbiology 2023Quote: ... S10-3 ITGB1 KO cells were transduced with pWPI-ITGB1 and selected in cDMEM supplemented with 400 μg/ml G418 (Invivogen). S10-3 WT cells were transduced with pTRIPZ-Rab5/7/11-GFP or EGFP-LAMP1 and selected in cDMEM supplemented with 2 μg/ml puromycin (Invivogen).
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 50 μg (day 3 analysis) or 100 μg (day 7 analysis) chicken ovalbumin (OVA) protein (InvivoGen) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zeocyin (1:1000; InvivoGen ant-zn-1). The PB-tetO-hygro ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zeocyin (1:1000; InvivoGen ant-zn-1), followed by clonal expansion.
-
bioRxiv - Molecular Biology 2023Quote: ... and THP-1 Null 1 ASC KD (InvivoGen) were maintained in complete RPMI 1640 (containing 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Immunology 2024Quote: ... FSL-1 (100 ng ml-1; Invivogen, USA), recombinant bovine (rbo ...
-
bioRxiv - Immunology 2021Quote: ... K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were selected with 1 µg ml-1 puromycin (InvivoGen, cat# ant-pr-1).
-
bioRxiv - Microbiology 2022Quote: ... 1 µg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg ml−1 Primocin (Invivogen ant-pm-1), 10μM SB202190 (Sigma Aldrich S7067) ...
-
bioRxiv - Cell Biology 2020Quote: ... After 1 week of Puromycin (1 μg/ml; InVivogen) or G418 (500 μg/ml ...
-
bioRxiv - Epidemiology 2019Quote: ... mixed 1:1 with Addavax (Invivogen, San Diego, USA), and between 0.6 and 1.2 ml were injected subcutaneously in the scruff of the neck.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg/ml of puromycin (InvivoGen, ant-pr-1) was added to the medium for 3 days to select cells for insertion of the Tir1 integration ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg/ml puromycin (InvivoGen, Cat# ant-pr-1) and 1% PS ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat Anti-Dectin-1 (1/200, InvivoGen mabg-mdect); Mouse Anti-6E10 (1/500 ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Cancer Biology 2022Quote: ... We selected infected human cell lines with 1 mg ml-1 blasticidin (InvivoGen, #ant-bl-1) for 14 days or with 1 mg ml-1 puromycin (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the cells were treated with 400 µM FFA and 3 µM HSG4112 in the presence or absence of bafilomycin A1 (Invivogen, tlrl-baf1). Cellular localization of LC3B was observed using a Carl Zeiss Confocal LSM710 Meta microscope and the images were processed with the software supplied by the manufacturer (Carl Zeiss ...
-
bioRxiv - Cell Biology 2019Quote: ... and primocin (100 μg ml-1) (ant-pm-1, InvivoGen).
-
bioRxiv - Pathology 2023Quote: ... and 1% gentamycin (G418, Invivogen cat. no. ant-gn-1). Primary human aortic SMCs (hVSMCs) ...
-
bioRxiv - Cell Biology 2024Quote: ... and blasticidin (30 µg/mL, InvivoGen, ant-bl-1: 1). The expression of proteins was induced with tetracyclin (1 µg/mL ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... 1× Primocin (InvivoGen) and 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA), and cells were filtered and plated at a density of 100,000 cells/cm2 onto uncoated tissue-culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.