Labshake search
Citations for Invivogen :
501 - 550 of 2179 citations for 5 Methoxy 2 2 4 4 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Microbiology 2024Quote: ... Cells transduced with lentiviruses encoding for the different gRNAs were passaged in selection medium containing 10 µg/ml blasticidin and 5 µg/ml puromycin (ant-pr-1, InvivoGen) to obtain polyclonal cell populations lacking either GSDMD or GSDME ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Microbiology 2022Quote: ... HEK-293T-hACE2 cells were grown in complete DMEM medium supplemented with zeocin (50 μg/mL; InvivoGen) (Glowacka et al. ...
-
bioRxiv - Immunology 2021Quote: ... IgA+ cells were detected by addition of goat anti-human IgA F(ab’)2 (InVivoGen) followed by anti-goat IgG AlexaFluor 594 (Jackson Immunoresearch ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg of M2ex3 antigen + 40 μg CpG (oligonucleotide 1826, a TLR9 agonist from InvivoGen), or 2 μg of M2ex3 + 40 μg STING agonist (2’3’-c-di-AM(PS)2(Rp,Rp) ...
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Microbiology 2020Quote: ... RAW 264.7 cells were selected with and maintained in Puromycin (InvivoGen, 5 μg/ml), Blasticidin (InvivoGen ...
-
bioRxiv - Cell Biology 2021Quote: ... we used 2.5 nM WR99210 (Jacobus Pharmaceuticals) or 5 μg/ml blasticidin S (InVivoGen), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected with 600 µg/ml of G418 (Invivogen: ant-gn-5) in DMEM with 10% FCS and 100U/ml P/S followed by single cell cloning ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Molecular Biology 2024Quote: ... cells were maintained in the presence of 5 µg/mL blasticidin (Invivogen, ant-bl) and 200 µg/mL zeocin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell colonies were subsequently isolated by selection with puromycin (5 µg/ml; InvivoGen) and the phenotype was analyzed by Western blot.
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
BET protein inhibition regulates macrophage chromatin accessibility and microbiota-dependent colitisbioRxiv - Immunology 2021Quote: ... or vehicle control for 12 hours followed by the addition of 50 ng/mL LPS (InvivoGen, #tlrl-peklps) for 4 hours ...
-
bioRxiv - Immunology 2023Quote: ... 1×106 UCBMC were stimulated for 6 hours at 37°C in RPMI supplemented with 10% FBS in the presence or absence of 0.5 μg/ml PMA and 5 μg/ml ionomycin (InvivoGen, San Diego, California). CD107a antibodies were added at the beginning of stimulation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stimulated with 2.5 µg/ml of R848 (Invivogen, catalog no. tlrl-r848-5) in complete medium (RPMI 1640 medium (catalog no ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by selection via addition of 5 μg/mL puromycin (cat# ant-pr-1, InvivoGen) over 10 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... H7-T7-IZ cells were maintained in a DMEM completed medium supplemented with 50 µg/ml of Zeocin (InvivoGen) and used for transfection of the T7 promoter-driven pTM expression vectors ...
-
bioRxiv - Developmental Biology 2024Quote: All cells were cultured in DMEM/F12 containing 10% FBS and Primocin (50 ng/ml) (InvivoGen, ant-pm-1). DPP4+ ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Cell Biology 2022Quote: ... followed by stimulation with 20.7 μM nigericin (Invivogen tlrl-nig; stock 5 mg/ml in ethanol) for 2 hours and 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... ABCs were induced in the presence of R848 (500 ng/ml, Invivogen, Cat#tlrl-r848-5), anti-CD40 (1 ug/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... Melanocytes were further isolated by 5-day exposure to 10µg/mL G418 (InvivoGen, ant-gn-1). BRAF status was confirmed via sanger sequencing (Quintarabio ...
-
bioRxiv - Molecular Biology 2021Quote: ... WT and E203Q in presence of puromycin and 200 µg/ml G418 (InvivoGen, #ant-gn-5). shRNA expression was induced by adding Doxycycline (Selleckchem ...
-
bioRxiv - Immunology 2021Quote: ... these were co-cultured 1:1 in complete RPMI containing OVA peptide (5 mg/mL, InvivoGen) and recombinant TGFβ (1 ng/mL ...
-
bioRxiv - Immunology 2020Quote: ... After 18 h cells were mock-transfected or transfected with 5 μg/ml HMW PolyIC (Invivogen) using Lipofectamine 2000 (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... seeded at low density the day after transfection and selected with Ganciclovir (5 μg/mL, Invivogen) for one week ...