Labshake search
Citations for Invivogen :
351 - 400 of 1179 citations for 5 MORPHOLIN 4 YLPENT 3 YN 1 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA), and cells were filtered and plated at a density of 100,000 cells/cm2 onto uncoated tissue-culture flasks ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of SpK combined with either BCG (BCGSpK) or 100 μg of Alhydrogel (Alum) (Invivogen, California, USA, AlumSpK), or a combination of BCG (5×105 CFU) ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transfected with 100 ng/ml of the RIG-I agonist 5’ triphosphate hairpin RNA (3p-hpRNA, Invivogen) complexed to Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Biochemistry 2019Quote: ... coli NucC bound to 5’-pApA or cAAA in hanging drop format by mixing protein (8-10 mg/mL) in crystallization buffer plus 0.1 mM 5’-pApA (Invivogen) or cAAA 1:1 with well solution containing 17-24% PEG 3350 ...
-
bioRxiv - Immunology 2021Quote: ... uninfected animals were treated intratracheally with 0.5 μg/kg of body weight of 5-OP-RU and 100 μg of CpG ODN 2006 (InvivoGen) mixed with 10 mg/kg of body weight of either rhesus macaque IgG4 isotype control antibody (DSPR4 ...
-
bioRxiv - Immunology 2020Quote: ... of 5 μg of each mAb (αDEC-NS1, αDCIR2-NS1, αDEC or αDCIR2) together with 50 μg poly (I:C) (Invivogen), exactly as described in (17) ...
-
bioRxiv - Microbiology 2021Quote: ... adjuvanted with MPLA-AddaVax (Per animal: 5 μg MPLAs, InvivoGen, cat# vac-mpls; 50μL AddaVax, InvivoGen, cat#-adx-vac) in a 100 µl injection volume via the intramuscular route (50 µl per hind leg) ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 1E3 or 1E4 colony forming units of Vaccinia Western Reserve or 5 μg of Poly I:C (Invivogen) with or without 5μgof anti-CD40 (FGK4.5 ...
-
bioRxiv - Genomics 2021Quote: ... 50,000 PBMCs from each individual were incubated for 10 hours at 37C and 5% CO2 in either the presence or absence of LPS (0.1 ug/mL, Invivogen ultrapure LPS from E ...
-
bioRxiv - Immunology 2024Quote: ... mice were immunized with 1E4 plaque-forming units (PFU) of Vaccinia Western Reserve or 5 µg of poly I:C (Invivogen) with or without 5 µg of anti-CD40 (FGK4.5 ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Genetics 2023Quote: ... the following were added directly to worm plates 3 days after injection: HygR selection −100 ul of 20 mg/ml Hygromycin (HygroGold™ InvivoGen, San Diego, CA) or Hygromycin B ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Immunology 2022Quote: ... blasticidin (Invivogen, cat. no. ant-bl-1, at 10 μg ml−1), and zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 1:1 vol/vol AddaVax (InvivoGen vac-adx-10) to reach a final dose of 1 µg (S2P ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% P/S and 100 µg/ml Normocin (Invivogen ant-nr-1). 10 µg/ml of Blasticidin (Invivogen ant-bl-05 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 1% Primocin (InvivoGen). Sphingosine-1-phosphate (0.2 - 2μM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg pppRNA (Invivogen) was added to 100 μl LyoVec (Invivogen) ...
-
bioRxiv - Immunology 2020Quote: ... Pam2CGDPKHPKSF (FSL-1) (InvivoGen) (200ng/ml) ...
-
bioRxiv - Immunology 2019Quote: ... R406 (1 µM; InvivoGen) was used for inhibiting Spleen tyrosine kinase activation ...
-
bioRxiv - Cell Biology 2023Quote: ... diABzL (1 μM, Invivogen), cGAMP (10 μg ml-1 ...
-
bioRxiv - Immunology 2023Quote: ... 60uM Necrostatin-1 (Invivogen) for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... Baylor College of Medicine) were immunized 5 times with CsCl2-gradient-purified TV at 10 μg/dose in AddaVax adjuvant (InvivoGen). Immunizations were given at 3-week intervals ...
-
bioRxiv - Cell Biology 2021Quote: ... The stably transduced population of cells was selected using appropriate antibiotics (5 ug/ml puromycin or 50-100 μg/ml hygromycin Gold, both from Invivogen) for at least 5 days ...
-
bioRxiv - Immunology 2020Quote: ... The K562 cell line was cultured in the same media than NK cells supplemented with 5 µg/mL of Plasmocin (InvivoGen) and was routinely tested for mycoplasma infection with Venor GeM Classic detection kit (Minerva Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... and 100 μg/ml streptomycin supplemented with 15 μg/ml Blasticidin and 100 μg/ml Hygromycin (Invivogen, #ant-hg-5) for 48 hours ...
-
bioRxiv - Genomics 2019Quote: ... at 37°C and 5% CO2 for 6 h (ex vivo culture) or treated with 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen) for 6 h (LPS stimulation) ...
-
bioRxiv - Microbiology 2019Quote: ... HEPES, sodium pyruvate (Multicell Wisent Inc., St-Bruno, Québec, Canada) and plasmocin 5 μg/ml (InvivoGen, San Diego, CA, USA). HeLa and MCF-7 cells (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... Mice were immunized by intranasal administration of the quadrivalent HA vaccine containing 150 ng of each HA with or without 5 μg of lipopolysaccharide (LPS; InvivoGen), 5 μg of poly(I:C ...
-
bioRxiv - Immunology 2022Quote: ... shControl and shLRBA HeLa cells were seeded at 0.3*106 cells in 6 well-plates followed by treatment for 16 h or 24 h with 5 μM of MG132 (InvivoGen) alone or in combination with 100 nM of Bafilomycin A1 for 3 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...