Labshake search
Citations for Invivogen :
301 - 350 of 433 citations for 4 Phenyl 3 buten 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the cells were treated with 400 µM FFA and 3 µM HSG4112 in the presence or absence of bafilomycin A1 (Invivogen, tlrl-baf1). Cellular localization of LC3B was observed using a Carl Zeiss Confocal LSM710 Meta microscope and the images were processed with the software supplied by the manufacturer (Carl Zeiss ...
-
bioRxiv - Immunology 2020Quote: ... with penicillin-streptomycin (100 units/mL) and activated using 3 µM CpG (ODN 7909) (tlrl-2006-1, Invivogen, San Diego, CA, USA). Cells were cultured in 200 µl medium for 1-8 days using round bottom 96-well plates ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Infected cells were selected for by the addition of 2 μg/mL puromycin (InvivoGen; ant-pr). Expression was verified by SDS-PAGE and/or BN-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibiotic selection was applied two days after transfection (2 μg/mL puromycin (#ant-pr-1, Invivogen) for 3 days).
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) primocin (InvivoGen, San Diego, CA) for 15 min at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Genetics 2023Quote: ... the following were added directly to worm plates 3 days after injection: HygR selection −100 ul of 20 mg/ml Hygromycin (HygroGold™ InvivoGen, San Diego, CA) or Hygromycin B ...
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were transferred into 10 cm dishes and selected with 2 µg ml-1 puromycin (InvivoGen). After 7-10 days ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Immunology 2021Quote: ... Mice (8 mice per group) were intramuscularly injected twice at four-week intervals with each VLPs (HA content=3 µg) with AddaVax™ adjuvant (Invivogen, San Diego, CA, USA) (Figure 2) ...
-
bioRxiv - Immunology 2022Quote: ... MDDCs were harvested and cultured over-night in media alone or in the presence of 5 μg/ml of a pool of 15-mer overlapping HIV-1 Gag peptides provided by the NIH AIDS Reagent Program (#11057) either individually or in combination with 1 μg/ml of 2’3’-c’diAM(PS)2 (Invivogen) STING agonist and 2.5 μg/ml of Poly I:C (SIGMA ...
-
bioRxiv - Immunology 2021Quote: ... in a final volume of 100 µL X-VIVOTM-15 + 2% HS + 1 µg.mL-1 poly(I:C) (tlrl-picw, Invivogen). After 3 h ...
-
bioRxiv - Immunology 2021Quote: ... Specific wells were pre-cultured for 2 hours with either 10mg/ml of TLR4 inhibitor (CLI-095, Invivogen) or 10mg/ml PI3 Kinase inhibitor (LY294002 ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ...
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Microbiology 2023Quote: ... ACE2 and transmembrane serine protease 2 (TMPRSS2)-expressing A549 (ACE2-TMPRSS2-A549) cells were from Invivogen (#a549-hace2tpsa) and HEK293T were from ATCC (#CRL-11268) ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...