Labshake search
Citations for Invivogen :
401 - 450 of 1454 citations for 6 Oxabicyclo 3.1.0 hexane 2 ethanol 4 4 difluoro 3 hydroxy 1S 1 α 2 bta 3 bta 5 α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Molecular Biology 2023Quote: ... DF-1 chicken fibroblasts were stimulated with the synthetic TLR2/6 antagonist Pam2CSK4 (InvivoGen tlrl-pms) at a final concentration of 10 µg/ml for the indicated times prior to lysis or fixation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Infected cells were selected for by the addition of 2 μg/mL puromycin (InvivoGen; ant-pr). Expression was verified by SDS-PAGE and/or BN-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Genetics 2023Quote: ... the following were added directly to worm plates 3 days after injection: HygR selection −100 ul of 20 mg/ml Hygromycin (HygroGold™ InvivoGen, San Diego, CA) or Hygromycin B ...
-
bioRxiv - Immunology 2021Quote: ... these were co-cultured 1:1 in complete RPMI containing OVA peptide (5 mg/mL, InvivoGen) and recombinant TGFβ (1 ng/mL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: THP1-Blue™ NF-κB cells (derived from the human THP-1 monocyte cell line by stable integration of an NF-kB-inducible secreted embryonic alkaline phosphatase (SEAP) reporter gene (InvivoGen, San Diego, CA, USA; 2 × 105 per well) were cultured in 96 well plate using RPMI containing 10 % heat inactivated FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 6 ug/mL blasticidine (Invivogen). 293T-Lα were cultured in DMEM medium (Gibco ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Immunology 2021Quote: ... Mice (8 mice per group) were intramuscularly injected twice at four-week intervals with each VLPs (HA content=3 µg) with AddaVax™ adjuvant (Invivogen, San Diego, CA, USA) (Figure 2) ...
-
bioRxiv - Immunology 2021Quote: ... Specific wells were pre-cultured for 2 hours with either 10mg/ml of TLR4 inhibitor (CLI-095, Invivogen) or 10mg/ml PI3 Kinase inhibitor (LY294002 ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Microbiology 2023Quote: ... ACE2 and transmembrane serine protease 2 (TMPRSS2)-expressing A549 (ACE2-TMPRSS2-A549) cells were from Invivogen (#a549-hace2tpsa) and HEK293T were from ATCC (#CRL-11268) ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Biochemistry 2020Quote: ... parasites were cultured with anhydrotetracycline medium at 250 nM (aTc+, MilliporeSigma) for 2 days before blasticidin /aTc+ medium was used (blasticidin at 2.5 µg/mL, InvivoGen).
-
bioRxiv - Bioengineering 2022Quote: ... Human codon optimized Delta full-length SARS-CoV-2 Spike protein plasmid was synthesized by Invivogen (plv-spike-v8).
-
bioRxiv - Immunology 2021Quote: ... in the left and right mid-thighs with 50 µg MD39 and 500 µg alum (Alhydrogel adjuvant 2%; InvivoGen) per side ...
-
bioRxiv - Neuroscience 2021Quote: ... endotoxin levels in exosomes and iPS-Mg medium were measured using the HEK Blue LPS detection kit 2 (InvivoGen) following manufacturers’ instructions ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... experiments were grown in Dulbecco’s modified Eagle’s medium DMEM supplemented with 10% fetal bovine serum and 50ug/ml normocin (ant-nr-2, Invivogen). HEK293 cells and other cell lines used were grown at 37°C and 5% CO2.
-
bioRxiv - Microbiology 2021Quote: BALB/c mice were immunized with 10 µg of SARS-CoV-2 RBD adjuvanted with 50% AddaVax™ (InvivoGen), via intramuscular route (i.m.) ...
-
bioRxiv - Bioengineering 2021Quote: ... of SARS-CoV-2 spike protein (NCBI Accession: YP 009724390.1) were synthesized and cloned into the pFUSE expression vector (InvivoGen). Both constructs contained an AVI-tag and a 6xHis tag at the C-terminus separated by a single G4S linker ...
-
bioRxiv - Immunology 2022Quote: ... CASP8-/- × MLKL-/- and subsequently derived gene-deficient BLaER1 macrophages were stimulated with 2 ng/mL LPS from E.coli (Invivogen) for 18 h ...
-
bioRxiv - Immunology 2023Quote: ... Dried lipid film was resuspended in 500 μL of buffer containing 25 mM Tris-HCl (pH 8.0) - 150 mM NaCl (Lp buffer) and 2 µg of recombinant human mIL-1β (Invivogen) or 10 µg of LDH (Sigma) ...
-
bioRxiv - Immunology 2023Quote: Cells were primed with 2 µg/mL (human primary Mo) or 10 µg/mL (BLaER1 Mo) of Pam3CSK4 (Invivogen) for 2 h before activation ...
-
bioRxiv - Immunology 2023Quote: ... of filtered PAO1 supernatant or TSB and KGMTM-2 containing purified flagellin at 1μg/ml or vehicle (tlrl-pafla; from P. aeruginosa; InvivoGen) were used for treating hTCEpi cells for various durations as indicated in the figure legends.