Labshake search
Citations for Invivogen :
351 - 400 of 1340 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... wildtype C57BL/6 were immunized by intraperitoneal injection of 5 µg Spike protein (5 µg, Bio-Techne) in presence of 10 µg CpG adjuvant (10 µg, ODN1826, Invivogen), followed by two reimmunization steps of 5 µg Spike protein in 10 µg CpG adjuvant every 15 days for a total of three immunizations.
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IL-10 cells were purchased from Invivogen (catalog no ...
-
bioRxiv - Immunology 2023Quote: ... HEK293-C34 cells were gifted by Y Matsuura at Osaka University and maintained in high-glucose DMEM (Nacalai Tesque) containing 10% FBS and 10 μg/mL blasticidin (solution) (InvivoGen, California, USA), and the exogenous expression of ACE2 and TMPRSS2 was induced by the addition of doxycycline hydrochloride (1 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... mixed with 10 µg CpG ODN 1668 adjuvant (InvivoGen). The following antigens were used ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were selected with 10 µg/mL blasticidin (Invivogen) for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2’3’-cGAMP (10 μg/ml, tlrl-nacga23, Invivogen). For AsiSI or I-PpoI nuclease induced DSBs ...
-
bioRxiv - Microbiology 2021Quote: ... cells were treated with 10 μg/mL Blasticidin (InvivoGen), 1 mg/mL Zeocin (InvivoGen) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were treated with 10 μg/ml LPS (Invivogen) for 6h.
-
bioRxiv - Immunology 2020Quote: ... Poly (I:C) (TLR3; vac-pic; Invivogen, 10 μg /ml), R837 (TLR7 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Blasticidin (5-10 µg/ml; Invivogen; ant-bl).
-
bioRxiv - Immunology 2019Quote: ... and 10 mg/mL Normocin (InvivoGen, San Diego, CA). Shortly before stereotactic injection ...
-
bioRxiv - Immunology 2019Quote: ... JNK pathway was blocked by SP600125 (10 µM; Invivogen). Rapamycin (10 nM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with the addition of blasticidin (10 μg ml1; Invivogen) and zeocin (Invivogen ...
-
bioRxiv - Genomics 2020Quote: ... 10 µg/mL of blasticidin (ant-bl-05, Invivogen), puromycin (P9620 ...
-
bioRxiv - Systems Biology 2023Quote: ... and selection began with 10 μg/mL blasticidin (InvivoGen) in T225 flasks ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were selected with 10 μg/mL blasticidin (InvivoGen) for 7 days ...
-
bioRxiv - Systems Biology 2023Quote: ... and selection began with 10 μg/mL blasticidin (InvivoGen) in T225 flasks ...
-
bioRxiv - Microbiology 2023Quote: ... or 10 μg of protein adjuvanted with AddaVax (Invivogen)156,157 ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were selected in 10 ug/ml Blasticidin (Invivogen), and sorted (Sony MA900 Multi-Application Cell Sorter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lm007 treated with 10 µg/ml of phleomycin (Invivogen) for 24 h was used as a positive control [45] ...
-
bioRxiv - Microbiology 2023Quote: ... cells were selected with 10 μg/mL blasticidin (Invivogen), refreshed every 3 – 4 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were selected in blasticidin (10 µg/ml, InvivoGen) for 4 days and Cas9 induced by doxycycline (1 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 μM Z-VAD-FMK (tlrl-vad, Invivogen) for 7 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were selected with Blasticidin (10 μg/mL, Invivogen), Hygromycin B (400 μg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 µg/ml of Blasticidin (Invivogen ant-bl-05) and 100 µg/ml of Zeocin (Invivogen ant-zn-05 ...
-
bioRxiv - Immunology 2020Quote: ... the cells were primed for 4 h with 500 ng/mL ultrapure LPS (InvivoGen). The supernatant was discharged and macrophages were infected with trypomastigote forms of T ...
-
bioRxiv - Biochemistry 2023Quote: ... and 50 µL of the working solution of the QUANTI1Luc 4 Lucia/Gaussia reagent (Invivogen) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg μl-1 primocin (Invivogen ant-pm-1), 20 mmol/L HEPES at pH 7.4 and 25 μmol/L cytochalasin D.
-
bioRxiv - Cancer Biology 2021Quote: ... or blasticidin (G7, R15 and R24: 10 µg/ml; InvivoGen) containing medium ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 µg/ml and 20 µg/ml) (InvivoGen, California, USA) After 24 hours incubation at 37 °C and 5% CO2 ...