Labshake search
Citations for Invivogen :
251 - 300 of 409 citations for 6 Fluoro 2 methylamino 4 1H pyrimidinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 500 μg/ml Bovine Serum Albumin (BSA) and 2 μg/ml Plasmocin (InvivoGen, USA). On day 18 ...
-
bioRxiv - Systems Biology 2022Quote: ... and cells were selected with 2 µg/mL puromycin (Invivogen, catalog # ant-pr-1) 96 hours post-transfection for 3 days ...
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Immunology 2019Quote: ... Cells were then washed 2 times followed by treatment with PMA (Invivogen; tlrl-pma) and 50ug/ml ionomycin (Invivogen ...
-
bioRxiv - Cell Biology 2021Quote: ... TANK-binding kinase 1 (TBK1) and IκB kinase ε (IKKε; BX795, 2 μM; Invivogen); receptor for advanced glycation end products (RAGE ...
-
bioRxiv - Genomics 2021Quote: ... followed by 48 hrs of puromycin selection (2 µg/ml, InvivoGen, San Diego CA), prior to experiments.
-
bioRxiv - Immunology 2022Quote: ... and then stimulated with 100µl of fresh medium containing 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... and then stimulated with 500µl of fresh medium containing 2’3’-cGAM(PS)2 (Invivogen) for 24 hours.
-
bioRxiv - Immunology 2023Quote: ... and positive cells were selected using 2 μg/mL puromycin (InvivoGen, ant-pr-1) for GFP and mCherry or 1 mg/mL G-418 solution (Roche ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...
-
bioRxiv - Cell Biology 2020Quote: ... Agonist were used as following concentrations: 5’ppp-dsRNA (2 μg/ml, tlrl-3prna, Invivogen) and 2’3’-cGAMP (10 μg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... resiquimod (2 mg/kg of a 1 mg/ ml solution in PBS, Invivogen tlrl-r848), were administered subcutaneously on E12.5 between 9:00-11:00 am and their conditions were monitored to ensure that there was no sign of any severe sickness symptoms or abnormalities.
-
bioRxiv - Immunology 2021Quote: ... transfection reagent (vehicle) and 2 μg/ml or 10 μg/ml ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...
-
bioRxiv - Immunology 2021Quote: ... IgA+ cells were detected by addition of goat anti-human IgA F(ab’)2 (InVivoGen) followed by anti-goat IgG AlexaFluor 594 (Jackson Immunoresearch ...
-
bioRxiv - Molecular Biology 2022Quote: ... aerogenes suspension (OD600 = 2) in SorMC and the indicated concentration of Hygromycin B Gold (InvivoGen) at 2×105 cells for AX4 or 1×105 cells for NC28.1 ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 2 μg/ml puromycin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot.
-
bioRxiv - Microbiology 2023Quote: ... 2 μg of M2ex3 antigen + 40 μg CpG (oligonucleotide 1826, a TLR9 agonist from InvivoGen), or 2 μg of M2ex3 + 40 μg STING agonist (2’3’-c-di-AM(PS)2(Rp,Rp) ...
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% advanced fetal bovine serum (FBS, Capricorn) and 2 µg/mL puromycin (InvivoGen). For AAV production ...
-
bioRxiv - Immunology 2023Quote: ... with 2% NuSerum medium (29) supplemented with Primocin (50 µg/ml, (InvivoGen, San Diego, CA), and retinoic acid (1 x 10−8 M ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Infected cells were selected for by the addition of 2 μg/mL puromycin (InvivoGen; ant-pr). Expression was verified by SDS-PAGE and/or BN-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibiotic selection was applied two days after transfection (2 μg/mL puromycin (#ant-pr-1, Invivogen) for 3 days).
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were transferred into 10 cm dishes and selected with 2 µg ml-1 puromycin (InvivoGen). After 7-10 days ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...